EMAIL THIS PAGE TO A FRIEND

MYLK4

myosin light chain kinase family, member 4

39 Gene Product Result for
Synonyms: SgK085
UniProtKB ID: Q86YV6, A2RUC0, Q5TAW2
Gene ID:
Mouse(238564) myosin light chain kinase family, member 4
Rat(100911165) myosin light chain kinase family, member 4
chicken(420893) myosin light chain kinase family, member 4
cow(518025) myosin light chain kinase family, member 4
Horse(100050092) myosin light chain kinase family, member 4
domestic cat(101088408) myosin light chain kinase family, member 4
dog(488190) myosin light chain kinase family, member 4
domestic guinea pig(100721558) myosin light chain kinase family, member 4
naked mole-rat(101701713) myosin light chain kinase family, member 4
Domestic Rabbit(100353972) myosin light chain kinase family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_111421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_111421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_111421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_373109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001166030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001166030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001166030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012418 Rosetta Predictions human pricing
XM_111421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229135 predicted 510
2 SASI_Hs01_00229137 predicted 314
3 SASI_Hs01_00229138 predicted 863
4 SASI_Hs01_00229139 predicted 1327
5 SASI_Hs01_00229140 predicted 1429
6 SASI_Hs01_00229141 predicted 1105
7 SASI_Hs02_00306133 predicted 992
8 SASI_Hs01_00229142 predicted 875
9 SASI_Hs01_00229143 predicted 428
10 SASI_Hs01_00229144 predicted 1339
11 SASI_Hs01_00229136 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_111421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238258 predicted 513
2 SASI_Mm01_00238259 predicted 475
3 SASI_Mm01_00238260 predicted 867
4 SASI_Mm01_00238261 predicted 807
5 SASI_Mm01_00238262 predicted 664
6 SASI_Mm01_00238263 predicted 382
7 SASI_Mm01_00238264 predicted 919
8 SASI_Mm01_00238265 predicted 468
9 SASI_Mm01_00238266 predicted 451
10 SASI_Mm01_00238267 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_111421
MYLK4 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1119s1c1
Sequence:CCGGCATTAAGACTAGAGGTGCAAACTCGAGTTTGCACCTCTAGTCTTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-647s1c1
Sequence:CCGGCCCATGAAAGGTGCATCAGTACTCGAGTACTGATGCACCTTTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1368s1c1
Sequence:CCGGCCAGATGTACATCCTCCACTTCTCGAGAAGTGGAGGATGTACATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-184s1c1
Sequence:CCGGGCACTAGATGAAAGGATAATTCTCGAGAATTATCCTTTCATCTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-29s1c1
Sequence:CCGGGCATGGAACAGCATAAACCATCTCGAGATGGTTTATGCTGTTCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_111421
MYLK4 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1119s1c1
Sequence:CCGGCATTAAGACTAGAGGTGCAAACTCGAGTTTGCACCTCTAGTCTTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-647s1c1
Sequence:CCGGCCCATGAAAGGTGCATCAGTACTCGAGTACTGATGCACCTTTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1368s1c1
Sequence:CCGGCCAGATGTACATCCTCCACTTCTCGAGAAGTGGAGGATGTACATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-184s1c1
Sequence:CCGGGCACTAGATGAAAGGATAATTCTCGAGAATTATCCTTTCATCTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-29s1c1
Sequence:CCGGGCATGGAACAGCATAAACCATCTCGAGATGGTTTATGCTGTTCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_111421
MYLK4 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1119s1c1
Sequence:CCGGCATTAAGACTAGAGGTGCAAACTCGAGTTTGCACCTCTAGTCTTAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-647s1c1
Sequence:CCGGCCCATGAAAGGTGCATCAGTACTCGAGTACTGATGCACCTTTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-1368s1c1
Sequence:CCGGCCAGATGTACATCCTCCACTTCTCGAGAAGTGGAGGATGTACATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-184s1c1
Sequence:CCGGGCACTAGATGAAAGGATAATTCTCGAGAATTATCCTTTCATCTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111421.2-29s1c1
Sequence:CCGGGCATGGAACAGCATAAACCATCTCGAGATGGTTTATGCTGTTCCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012418
MYLK4 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase family, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012418.1-4432s1c1
Sequence:CCGGGCATGCCACATTGGTAATTTGCTCGAGCAAATTACCAATGTGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-778s1c1
Sequence:CCGGGCGAACCTCATCCAGCTGTACCTCGAGGTACAGCTGGATGAGGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1328s21c1
Sequence:CCGGAGGAGAAGAGTTGGCGAATAACTCGAGTTATTCGCCAACTCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-1297s1c1
Sequence:CCGGGCCAAGGAGTTCATCTCTAAGCTCGAGCTTAGAGATGAACTCCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1170s21c1
Sequence:CCGGCATCGCCTATATGCTACTTAGCTCGAGCTAAGTAGCATATAGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-874s21c1
Sequence:CCGGATCGATGAGAGCTACAATTTGCTCGAGCAAATTGTAGCTCTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012418
MYLK4 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase family, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012418.1-4432s1c1
Sequence:CCGGGCATGCCACATTGGTAATTTGCTCGAGCAAATTACCAATGTGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-778s1c1
Sequence:CCGGGCGAACCTCATCCAGCTGTACCTCGAGGTACAGCTGGATGAGGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1328s21c1
Sequence:CCGGAGGAGAAGAGTTGGCGAATAACTCGAGTTATTCGCCAACTCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-1297s1c1
Sequence:CCGGGCCAAGGAGTTCATCTCTAAGCTCGAGCTTAGAGATGAACTCCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1170s21c1
Sequence:CCGGCATCGCCTATATGCTACTTAGCTCGAGCTAAGTAGCATATAGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-874s21c1
Sequence:CCGGATCGATGAGAGCTACAATTTGCTCGAGCAAATTGTAGCTCTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012418
MYLK4 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase family, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012418.1-4432s1c1
Sequence:CCGGGCATGCCACATTGGTAATTTGCTCGAGCAAATTACCAATGTGGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-778s1c1
Sequence:CCGGGCGAACCTCATCCAGCTGTACCTCGAGGTACAGCTGGATGAGGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1328s21c1
Sequence:CCGGAGGAGAAGAGTTGGCGAATAACTCGAGTTATTCGCCAACTCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012418.1-1297s1c1
Sequence:CCGGGCCAAGGAGTTCATCTCTAAGCTCGAGCTTAGAGATGAACTCCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-1170s21c1
Sequence:CCGGCATCGCCTATATGCTACTTAGCTCGAGCTAAGTAGCATATAGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012418.3-874s21c1
Sequence:CCGGATCGATGAGAGCTACAATTTGCTCGAGCAAATTGTAGCTCTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373109
MYLK4 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase family, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1489s1c1
Sequence:CCGGCCAGGACTTTGTGACCAAATACTCGAGTATTTGGTCACAAAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-646s1c1
Sequence:CCGGCAGCTTCTATACTGTGAGCAACTCGAGTTGCTCACAGTATAGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-850s1c1
Sequence:CCGGCTTCGAGTCTAAGAACGACATCTCGAGATGTCGTTCTTAGACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1045s1c1
Sequence:CCGGGTGTGTGAATCGGGATGCTAACTCGAGTTAGCATCCCGATTCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373109
MYLK4 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase family, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1489s1c1
Sequence:CCGGCCAGGACTTTGTGACCAAATACTCGAGTATTTGGTCACAAAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-646s1c1
Sequence:CCGGCAGCTTCTATACTGTGAGCAACTCGAGTTGCTCACAGTATAGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-850s1c1
Sequence:CCGGCTTCGAGTCTAAGAACGACATCTCGAGATGTCGTTCTTAGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1045s1c1
Sequence:CCGGGTGTGTGAATCGGGATGCTAACTCGAGTTAGCATCCCGATTCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373109
MYLK4 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase family, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1489s1c1
Sequence:CCGGCCAGGACTTTGTGACCAAATACTCGAGTATTTGGTCACAAAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-646s1c1
Sequence:CCGGCAGCTTCTATACTGTGAGCAACTCGAGTTGCTCACAGTATAGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-850s1c1
Sequence:CCGGCTTCGAGTCTAAGAACGACATCTCGAGATGTCGTTCTTAGACTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373109.2-1045s1c1
Sequence:CCGGGTGTGTGAATCGGGATGCTAACTCGAGTTAGCATCCCGATTCACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001166030
MYLK4 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase family, member 4
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000432724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-1227s21c1
Sequence:CCGGATCCATGAAAGGAGCCTATTCCTCGAGGAATAGGCTCCTTTCATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-327s21c1
Sequence:CCGGATTTGATCATCGGATGGTAATCTCGAGATTACCATCCGATGATCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001166030
MYLK4 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase family, member 4
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000432724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-1227s21c1
Sequence:CCGGATCCATGAAAGGAGCCTATTCCTCGAGGAATAGGCTCCTTTCATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-327s21c1
Sequence:CCGGATTTGATCATCGGATGGTAATCTCGAGATTACCATCCGATGATCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001166030
MYLK4 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase family, member 4
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000432724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-1227s21c1
Sequence:CCGGATCCATGAAAGGAGCCTATTCCTCGAGGAATAGGCTCCTTTCATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166030.1-327s21c1
Sequence:CCGGATTTGATCATCGGATGGTAATCTCGAGATTACCATCCGATGATCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)