EMAIL THIS PAGE TO A FRIEND

MYLK

myosin light chain kinase

282 Gene Product Result for
Synonyms: AAT7 KRP MLCK MLCK1 MLCK108 MLCK210 MSTP083 MYLK1 smMLCK
Gene ID:
Human(4638) Summary: This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
Mouse(107589) myosin, light polypeptide kinase
Rat(288057) myosin light chain kinase
chicken(396445) myosin light chain kinase
dog(488012) myosin light chain kinase
Horse(100070482) myosin light chain kinase
cow(338037) myosin light chain kinase
naked mole-rat(101704236) myosin light chain kinase
Domestic Rabbit(100009143) myosin light chain kinase
domestic guinea pig(100714177) myosin light chain kinase
sheep(443334) myosin light chain kinase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
I2764 ML-7 powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053028 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005965 Rosetta Predictions human pricing
NM_053025 Rosetta Predictions human pricing
NM_053026 Rosetta Predictions human pricing
NM_053027 Rosetta Predictions human pricing
NM_053028 Rosetta Predictions human pricing
NM_053029 Rosetta Predictions human pricing
NM_053030 Rosetta Predictions human pricing
NM_053031 Rosetta Predictions human pricing
NM_053032 Rosetta Predictions human pricing
NM_001105874 Rosetta Predictions rat pricing
NM_139300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086850 predicted 3637
2 SASI_Hs01_00086851 predicted 3643
3 SASI_Hs01_00086852 predicted 3633
4 SASI_Hs01_00086853 predicted 3808
5 SASI_Hs01_00086854 predicted 3835
6 SASI_Hs01_00086855 predicted 3819
7 SASI_Hs01_00086856 predicted 418
8 SASI_Hs01_00086857 predicted 1970
9 SASI_Hs01_00086858 predicted 2208
10 SASI_Hs01_00086859 predicted 2043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194703 predicted 6300
2 SASI_Hs01_00194704 predicted 6313
3 SASI_Hs01_00194705 predicted 6302
4 SASI_Hs01_00194706 predicted 6470
5 SASI_Hs01_00194707 predicted 6498
6 SASI_Hs01_00194708 predicted 6479
7 SASI_Hs01_00194709 predicted 3082
8 SASI_Hs01_00194710 predicted 1093
9 SASI_Hs01_00194711 predicted 1848
10 SASI_Hs01_00194712 predicted 4875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011156 predicted 6095
2 SASI_Hs01_00011157 predicted 6103
3 SASI_Hs01_00011158 predicted 6096
4 SASI_Hs01_00011159 predicted 6264
5 SASI_Hs01_00011160 predicted 6292
6 SASI_Hs01_00011161 predicted 6279
7 SASI_Hs01_00011162 predicted 2871
8 SASI_Hs01_00011163 predicted 1094
9 SASI_Hs01_00011164 predicted 1642
10 SASI_Hs01_00011165 predicted 4669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205625 predicted 6152
2 SASI_Hs01_00205626 predicted 6156
3 SASI_Hs01_00205627 predicted 6147
4 SASI_Hs01_00205628 predicted 6319
5 SASI_Hs01_00205629 predicted 6349
6 SASI_Hs01_00205630 predicted 6327
7 SASI_Hs01_00205631 predicted 3080
8 SASI_Hs01_00205632 predicted 1097
9 SASI_Hs01_00205633 predicted 1848
10 SASI_Hs01_00205634 predicted 4870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114756 predicted 5947
2 SASI_Hs01_00114757 predicted 5955
3 SASI_Hs01_00114758 predicted 5935
4 SASI_Hs01_00114759 predicted 6118
5 SASI_Hs01_00114760 predicted 6135
6 SASI_Hs01_00114761 predicted 6122
7 SASI_Hs01_00114762 predicted 2869
8 SASI_Hs01_00114763 predicted 1090
9 SASI_Hs01_00114764 predicted 1638
10 SASI_Hs01_00114765 predicted 4664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147722 predicted 3090
2 SASI_Hs01_00147723 predicted 4639
3 SASI_Hs01_00147724 predicted 1101
4 SASI_Hs01_00147725 predicted 1852
5 SASI_Hs01_00147726 predicted 1366
6 SASI_Hs01_00147727 predicted 1113
7 SASI_Hs01_00147728 predicted 4538
8 SASI_Hs01_00147729 predicted 4502
9 SASI_Hs01_00147730 predicted 4340
10 SASI_Hs01_00147731 predicted 2687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031778 predicted 3652
2 SASI_Hs01_00031779 predicted 3659
3 SASI_Hs01_00031780 predicted 3649
4 SASI_Hs01_00031781 predicted 3820
5 SASI_Hs01_00031782 predicted 3847
6 SASI_Hs01_00031783 predicted 3831
7 SASI_Hs01_00031784 predicted 434
8 SASI_Hs01_00031785 predicted 1980
9 SASI_Hs01_00031786 predicted 2224
10 SASI_Hs01_00031787 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072760 predicted 1127
2 SASI_Hs01_00072761 predicted 1138
3 SASI_Hs01_00072762 predicted 1121
4 SASI_Hs01_00072763 predicted 1296
5 SASI_Hs01_00072764 predicted 1321
6 SASI_Hs01_00072765 predicted 1303
7 SASI_Hs01_00072766 predicted 1061
8 SASI_Hs01_00072768 predicted 1015
9 SASI_Hs01_00072769 predicted 967
10 SASI_Hs02_00361847 predicted 993
11 SASI_Hs01_00072767 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108671 predicted 1130
2 SASI_Hs01_00108672 predicted 1141
3 SASI_Hs01_00108673 predicted 1130
4 SASI_Hs01_00108674 predicted 1297
5 SASI_Hs01_00108675 predicted 1322
6 SASI_Hs01_00108676 predicted 1310
7 SASI_Hs01_00108677 predicted 1089
8 SASI_Hs01_00108678 predicted 1000
9 SASI_Hs01_00108680 predicted 1097
10 SASI_Hs02_00361848 predicted 392
11 SASI_Hs01_00108679 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213382 predicted 4470
2 SASI_Rn02_00213383 predicted 5230
3 SASI_Rn02_00213384 predicted 5000
4 SASI_Rn02_00213385 predicted 4993
5 SASI_Rn02_00213386 predicted 4338
6 SASI_Rn02_00213387 predicted 5051
7 SASI_Rn02_00213388 predicted 5168
8 SASI_Rn02_00213389 predicted 5063
9 SASI_Rn02_00213390 predicted 4408
10 SASI_Rn02_00213391 predicted 4462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339987 predicted 5564
2 SASI_Mm02_00339988 predicted 4654
3 SASI_Mm01_00174571 predicted 5430
4 SASI_Mm01_00174572 predicted 4197
5 SASI_Mm01_00174573 predicted 2747
6 SASI_Mm01_00174574 predicted 2829
7 SASI_Mm01_00174575 predicted 4479
8 SASI_Mm02_00339989 predicted 4911
9 SASI_Mm01_00174576 predicted 3323
10 SASI_Mm02_00339990 predicted 5193
11 SASI_Mm01_00174568 predicted 3621
12 SASI_Mm01_00174569 predicted 1833
13 SASI_Mm01_00174570 predicted 4555
14 SASI_Mm01_00174577 predicted 5530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139300
VALIDATED
MYLK MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5652s1c1
Sequence:CCGGGCTAGATTTGACTGCAAGATTCTCGAGAATCTTGCAGTCAAATCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-713s1c1
Sequence:CCGGCGTGTCAATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATTGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-132s1c1
Sequence:CCGGGCCTCGTCACACATGTCTAAACTCGAGTTTAGACATGTGTGACGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5523s1c1
Sequence:CCGGGCGGAGAAACTAGAGTCTGAACTCGAGTTCAGACTCTAGTTTCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139300.2-4853s1c1
Sequence:CCGGGCGGGAGTGTATCAAGTACATCTCGAGATGTACTTGATACACTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6027s21c1
Sequence:CCGGGATGATCTAGTTAGGCTATTTCTCGAGAAATAGCCTAACTAGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-4358s21c1
Sequence:CCGGTGCGTGCAGTCAACGTCTATGCTCGAGCATAGACGTTGACTGCACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6161s21c1
Sequence:CCGGATCACCAGCAACTCGTCTAATCTCGAGATTAGACGAGTTGCTGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6073s21c1
Sequence:CCGGGCTGATGCCTGGGAGATATACCTCGAGGTATATCTCCCAGGCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-5103s21c1
Sequence:CCGGTATTCTGGTCAGCGGACTTTCCTCGAGGAAAGTCCGCTGACCAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139300
VALIDATED
MYLK MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5652s1c1
Sequence:CCGGGCTAGATTTGACTGCAAGATTCTCGAGAATCTTGCAGTCAAATCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-713s1c1
Sequence:CCGGCGTGTCAATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATTGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-132s1c1
Sequence:CCGGGCCTCGTCACACATGTCTAAACTCGAGTTTAGACATGTGTGACGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5523s1c1
Sequence:CCGGGCGGAGAAACTAGAGTCTGAACTCGAGTTCAGACTCTAGTTTCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139300.2-4853s1c1
Sequence:CCGGGCGGGAGTGTATCAAGTACATCTCGAGATGTACTTGATACACTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6027s21c1
Sequence:CCGGGATGATCTAGTTAGGCTATTTCTCGAGAAATAGCCTAACTAGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-4358s21c1
Sequence:CCGGTGCGTGCAGTCAACGTCTATGCTCGAGCATAGACGTTGACTGCACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6161s21c1
Sequence:CCGGATCACCAGCAACTCGTCTAATCTCGAGATTAGACGAGTTGCTGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6073s21c1
Sequence:CCGGGCTGATGCCTGGGAGATATACCTCGAGGTATATCTCCCAGGCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-5103s21c1
Sequence:CCGGTATTCTGGTCAGCGGACTTTCCTCGAGGAAAGTCCGCTGACCAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139300
VALIDATED
MYLK MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5652s1c1
Sequence:CCGGGCTAGATTTGACTGCAAGATTCTCGAGAATCTTGCAGTCAAATCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-713s1c1
Sequence:CCGGCGTGTCAATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATTGACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-132s1c1
Sequence:CCGGGCCTCGTCACACATGTCTAAACTCGAGTTTAGACATGTGTGACGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139300.2-5523s1c1
Sequence:CCGGGCGGAGAAACTAGAGTCTGAACTCGAGTTCAGACTCTAGTTTCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139300.2-4853s1c1
Sequence:CCGGGCGGGAGTGTATCAAGTACATCTCGAGATGTACTTGATACACTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6027s21c1
Sequence:CCGGGATGATCTAGTTAGGCTATTTCTCGAGAAATAGCCTAACTAGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-4358s21c1
Sequence:CCGGTGCGTGCAGTCAACGTCTATGCTCGAGCATAGACGTTGACTGCACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6161s21c1
Sequence:CCGGATCACCAGCAACTCGTCTAATCTCGAGATTAGACGAGTTGCTGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139300.3-6073s21c1
Sequence:CCGGGCTGATGCCTGGGAGATATACCTCGAGGTATATCTCCCAGGCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139300.3-5103s21c1
Sequence:CCGGTATTCTGGTCAGCGGACTTTCCTCGAGGAAAGTCCGCTGACCAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053028
VALIDATED
MYLK MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-4913s1c1
Sequence:CCGGGCTAATGAAAGATACCAAGAACTCGAGTTCTTGGTATCTTTCATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-479s1c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-1470s1c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-5030s1c1
Sequence:CCGGACTGTCCTCTATGGCAATGATCTCGAGATCATTGCCATAGAGGACAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-5343s1c1
Sequence:CCGGGACGGGAACTGCTCTTTAATTCTCGAGAATTAAAGAGCAGTTCCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-6788s1c1
Sequence:CCGGGCACTCAGACTTGCGTCTTTACTCGAGTAAAGACGCAAGTCTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-1105s1c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053028.2-6697s1c1
Sequence:CCGGCCTACCTTATGGGTTCCATATCTCGAGATATGGAACCCATAAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.2-760s1c1
Sequence:CCGGCCACCAAAGTTTGCTACCAAGCTCGAGCTTGGTAGCAAACTTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-7192s1c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053028.2-4961s1c1
Sequence:CCGGCTCCTGAAGTGATCAACTATGCTCGAGCATAGTTGATCACTTCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1633s21c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1105s21c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-642s21c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053028.3-7192s21c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053028
VALIDATED
MYLK MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-4913s1c1
Sequence:CCGGGCTAATGAAAGATACCAAGAACTCGAGTTCTTGGTATCTTTCATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-479s1c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-1470s1c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-5030s1c1
Sequence:CCGGACTGTCCTCTATGGCAATGATCTCGAGATCATTGCCATAGAGGACAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-5343s1c1
Sequence:CCGGGACGGGAACTGCTCTTTAATTCTCGAGAATTAAAGAGCAGTTCCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-6788s1c1
Sequence:CCGGGCACTCAGACTTGCGTCTTTACTCGAGTAAAGACGCAAGTCTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-1105s1c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053028.2-6697s1c1
Sequence:CCGGCCTACCTTATGGGTTCCATATCTCGAGATATGGAACCCATAAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.2-760s1c1
Sequence:CCGGCCACCAAAGTTTGCTACCAAGCTCGAGCTTGGTAGCAAACTTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-7192s1c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053028.2-4961s1c1
Sequence:CCGGCTCCTGAAGTGATCAACTATGCTCGAGCATAGTTGATCACTTCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1633s21c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1105s21c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-642s21c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053028.3-7192s21c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053028
VALIDATED
MYLK MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-4913s1c1
Sequence:CCGGGCTAATGAAAGATACCAAGAACTCGAGTTCTTGGTATCTTTCATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-479s1c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-1470s1c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.x-5030s1c1
Sequence:CCGGACTGTCCTCTATGGCAATGATCTCGAGATCATTGCCATAGAGGACAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.x-5343s1c1
Sequence:CCGGGACGGGAACTGCTCTTTAATTCTCGAGAATTAAAGAGCAGTTCCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-6788s1c1
Sequence:CCGGGCACTCAGACTTGCGTCTTTACTCGAGTAAAGACGCAAGTCTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-1105s1c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053028.2-6697s1c1
Sequence:CCGGCCTACCTTATGGGTTCCATATCTCGAGATATGGAACCCATAAGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053028.2-760s1c1
Sequence:CCGGCCACCAAAGTTTGCTACCAAGCTCGAGCTTGGTAGCAAACTTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_053028.2-7192s1c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053028.2-4961s1c1
Sequence:CCGGCTCCTGAAGTGATCAACTATGCTCGAGCATAGTTGATCACTTCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1633s21c1
Sequence:CCGGCTGAAGGACTGCGCTGTTATTCTCGAGAATAACAGCGCAGTCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-1105s21c1
Sequence:CCGGGTGACCAATGTAATCTCAAAGCTCGAGCTTTGAGATTACATTGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053028.3-642s21c1
Sequence:CCGGGTTGACAGTAGAAGGAAGTTTCTCGAGAAACTTCCTTCTACTGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053028.3-7192s21c1
Sequence:CCGGCCACAGTATTGCCACAGTTTACTCGAGTAAACTGTGGCAATACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)