EMAIL THIS PAGE TO A FRIEND

MYLPF

myosin light chain, phosphorylatable, fast skeletal muscle

54 Gene Product Result for
Synonyms: HUMMLC2B MRLC2 MYL11
UniProtKB ID: Q96A32, B2RA83, Q14843, Q6IB41
Gene ID:
Mouse(17907) myosin light chain, phosphorylatable, fast skeletal muscle
Rat(24584) myosin light chain, phosphorylatable, fast skeletal muscle
chicken(776775) myosin light chain, phosphorylatable, fast skeletal muscle
dog(479772) myosin regulatory light chain 2, skeletal muscle isoform type 2-like
cow(514106) myosin light chain, phosphorylatable, fast skeletal muscle
sheep(100270715) myosin light chain, phosphorylatable, fast skeletal muscle
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032421 MISSION® esiRNA esiRNA human AC127457.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013292 Rosetta Predictions human pricing
NM_012605 Rosetta Predictions rat pricing
NM_016754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140686 predicted 244
2 SASI_Hs02_00344564 predicted 264
3 SASI_Hs02_00344565 predicted 332
4 SASI_Hs01_00140687 predicted 294
5 SASI_Hs02_00344566 predicted 271
6 SASI_Hs02_00344567 predicted 429
7 SASI_Hs02_00344568 predicted 222
8 SASI_Hs02_00344569 predicted 223
9 SASI_Hs01_00140692 predicted 341
10 SASI_Hs02_00344570 predicted 368
11 SASI_Hs01_00140688 predicted 376
12 SASI_Hs01_00140689 predicted 395
13 SASI_Hs01_00140690 predicted 384
14 SASI_Hs01_00140691 predicted 274
15 SASI_Hs01_00140693 predicted 352
16 SASI_Hs01_00140694 predicted 402
17 SASI_Hs01_00140695 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073415 predicted 248
2 SASI_Rn02_00259777 predicted 211
3 SASI_Rn02_00259778 predicted 277
4 SASI_Rn01_00073416 predicted 252
5 SASI_Rn02_00259779 predicted 195
6 SASI_Rn02_00259780 predicted 411
7 SASI_Rn02_00259781 predicted 233
8 SASI_Rn01_00073419 predicted 257
9 SASI_Rn01_00073420 predicted 283
10 SASI_Rn02_00259782 predicted 234
11 SASI_Rn01_00073417 predicted 202
12 SASI_Rn01_00073418 predicted 219
13 SASI_Rn01_00073421 predicted 219
14 SASI_Rn01_00073422 predicted 237
15 SASI_Rn01_00073423 predicted 288
16 SASI_Rn01_00073424 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050971 predicted 347
2 SASI_Mm01_00050972 predicted 296
3 SASI_Mm01_00050974 predicted 248
4 SASI_Mm01_00050975 predicted 334
5 SASI_Mm01_00050976 predicted 204
6 SASI_Mm01_00050977 predicted 282
7 SASI_Mm01_00050978 predicted 351
8 SASI_Mm01_00050979 predicted 316
9 SASI_Mm01_00050980 predicted 231
10 SASI_Mm02_00323490 predicted 444
11 SASI_Mm01_00050973 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013292
MYLPF MISSION shRNA Bacterial Glycerol Stock
myosin light chain, phosphorylatable, fast skeletal muscle
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-179s1c1
Sequence:CCGGCCGTGATGGTATTATAGACAACTCGAGTTGTCTATAATACCATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-398s1c1
Sequence:CCGGCACCATCAAGAAGAAGTTCCTCTCGAGAGGAACTTCTTCTTGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-345s1c1
Sequence:CCGGCCTGAGGATGTGATCACCGGACTCGAGTCCGGTGATCACATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-158s1c1
Sequence:CCGGCTTCACTGTGATCGACCAGAACTCGAGTTCTGGTCGATCACAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-233s1c1
Sequence:CCGGCCGCCTCAATGTGAAGAATGACTCGAGTCATTCTTCACATTGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-498s21c1
Sequence:CCGGGGCGGCAACGTCGACTACAAACTCGAGTTTGTAGTCGACGTTGCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-296s21c1
Sequence:CCGGCACCGTCTTCCTGACCATGTTCTCGAGAACATGGTCAGGAAGACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-120s21c1
Sequence:CCGGTTCGACCAGACTCAGATCCAGCTCGAGCTGGATCTGAGTCTGGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-250s21c1
Sequence:CCGGAGGAGTTGGATGCCATGATGACTCGAGTCATCATGGCATCCAACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013292
MYLPF MISSION shRNA shRNA Plasmid DNA
myosin light chain, phosphorylatable, fast skeletal muscle
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-179s1c1
Sequence:CCGGCCGTGATGGTATTATAGACAACTCGAGTTGTCTATAATACCATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-398s1c1
Sequence:CCGGCACCATCAAGAAGAAGTTCCTCTCGAGAGGAACTTCTTCTTGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-345s1c1
Sequence:CCGGCCTGAGGATGTGATCACCGGACTCGAGTCCGGTGATCACATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-158s1c1
Sequence:CCGGCTTCACTGTGATCGACCAGAACTCGAGTTCTGGTCGATCACAGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-233s1c1
Sequence:CCGGCCGCCTCAATGTGAAGAATGACTCGAGTCATTCTTCACATTGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-498s21c1
Sequence:CCGGGGCGGCAACGTCGACTACAAACTCGAGTTTGTAGTCGACGTTGCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-296s21c1
Sequence:CCGGCACCGTCTTCCTGACCATGTTCTCGAGAACATGGTCAGGAAGACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-120s21c1
Sequence:CCGGTTCGACCAGACTCAGATCCAGCTCGAGCTGGATCTGAGTCTGGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-250s21c1
Sequence:CCGGAGGAGTTGGATGCCATGATGACTCGAGTCATCATGGCATCCAACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013292
MYLPF MISSION shRNA Lentiviral Transduction Particles
myosin light chain, phosphorylatable, fast skeletal muscle
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-179s1c1
Sequence:CCGGCCGTGATGGTATTATAGACAACTCGAGTTGTCTATAATACCATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-398s1c1
Sequence:CCGGCACCATCAAGAAGAAGTTCCTCTCGAGAGGAACTTCTTCTTGATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-345s1c1
Sequence:CCGGCCTGAGGATGTGATCACCGGACTCGAGTCCGGTGATCACATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-158s1c1
Sequence:CCGGCTTCACTGTGATCGACCAGAACTCGAGTTCTGGTCGATCACAGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013292.2-233s1c1
Sequence:CCGGCCGCCTCAATGTGAAGAATGACTCGAGTCATTCTTCACATTGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-498s21c1
Sequence:CCGGGGCGGCAACGTCGACTACAAACTCGAGTTTGTAGTCGACGTTGCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-296s21c1
Sequence:CCGGCACCGTCTTCCTGACCATGTTCTCGAGAACATGGTCAGGAAGACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-120s21c1
Sequence:CCGGTTCGACCAGACTCAGATCCAGCTCGAGCTGGATCTGAGTCTGGTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013292.3-250s21c1
Sequence:CCGGAGGAGTTGGATGCCATGATGACTCGAGTCATCATGGCATCCAACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016754
MYLPF MISSION shRNA Bacterial Glycerol Stock
myosin light chain, phosphorylatable, fast skeletal muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-359s1c1
Sequence:CCGGGCTATGATGAAGGAAGCCAGTCTCGAGACTGGCTTCCTTCATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-253s1c1
Sequence:CCGGGTTCACTGTAATTGATCAGAACTCGAGTTCTGATCAATTACAGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-275s1c1
Sequence:CCGGAGGGATGGCATTATCGACAAACTCGAGTTTGTCGATAATGCCATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-527s1c1
Sequence:CCGGACCACGCAGTGCGACCGATTTCTCGAGAAATCGGTCGCACTGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-382s1c1
Sequence:CCGGGCCCATCAACTTCACTGTCTTCTCGAGAAGACAGTGAAGTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016754
MYLPF MISSION shRNA shRNA Plasmid DNA
myosin light chain, phosphorylatable, fast skeletal muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-359s1c1
Sequence:CCGGGCTATGATGAAGGAAGCCAGTCTCGAGACTGGCTTCCTTCATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-253s1c1
Sequence:CCGGGTTCACTGTAATTGATCAGAACTCGAGTTCTGATCAATTACAGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-275s1c1
Sequence:CCGGAGGGATGGCATTATCGACAAACTCGAGTTTGTCGATAATGCCATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-527s1c1
Sequence:CCGGACCACGCAGTGCGACCGATTTCTCGAGAAATCGGTCGCACTGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-382s1c1
Sequence:CCGGGCCCATCAACTTCACTGTCTTCTCGAGAAGACAGTGAAGTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016754
MYLPF MISSION shRNA Lentiviral Transduction Particles
myosin light chain, phosphorylatable, fast skeletal muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-359s1c1
Sequence:CCGGGCTATGATGAAGGAAGCCAGTCTCGAGACTGGCTTCCTTCATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-253s1c1
Sequence:CCGGGTTCACTGTAATTGATCAGAACTCGAGTTCTGATCAATTACAGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-275s1c1
Sequence:CCGGAGGGATGGCATTATCGACAAACTCGAGTTTGTCGATAATGCCATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-527s1c1
Sequence:CCGGACCACGCAGTGCGACCGATTTCTCGAGAAATCGGTCGCACTGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016754.3-382s1c1
Sequence:CCGGGCCCATCAACTTCACTGTCTTCTCGAGAAGACAGTGAAGTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)