EMAIL THIS PAGE TO A FRIEND

MYNN

myoneurin

177 Gene Product Result for
Synonyms: OSZF ZBTB31 ZNF902
Gene ID:
Human(55892) Summary: This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Mouse(80732) myoneurin
Rat(361924) myoneurin
sheep(101120539) myoneurin
Zebrafish(327167) myoneurin
cow(539376) myoneurin
Horse(100063289) myoneurin
dog(488150) myoneurin
chicken(771218) myoneurin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018657 Rosetta Predictions human pricing
NM_001012178 Rosetta Predictions rat pricing
NM_030557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352159 predicted 1604
2 SASI_Hs01_00201677 predicted 1168
3 SASI_Hs01_00201678 predicted 1714
4 SASI_Hs01_00201679 predicted 2189
5 SASI_Hs01_00201680 predicted 521
6 SASI_Hs01_00201682 predicted 1660
7 SASI_Hs01_00201683 predicted 1751
8 SASI_Hs01_00201685 predicted 865
9 SASI_Hs01_00201686 predicted 1772
10 SASI_Hs02_00352160 predicted 2168
11 SASI_Hs01_00201681 predicted 1785
12 SASI_Hs01_00201684 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200379 predicted 1124
2 SASI_Rn01_00055356 predicted 937
3 SASI_Rn01_00055358 predicted 1583
4 SASI_Rn01_00055359 predicted 328
5 SASI_Rn01_00055360 predicted 435
6 SASI_Rn01_00055361 predicted 357
7 SASI_Rn02_00200380 predicted 887
8 SASI_Rn02_00200381 predicted 519
9 SASI_Rn01_00055364 predicted 1181
10 SASI_Rn01_00055365 predicted 1355
11 SASI_Rn01_00055357 predicted 655
12 SASI_Rn01_00055362 predicted 290
13 SASI_Rn01_00055363 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336762 predicted 1993
2 SASI_Mm01_00196499 predicted 735
3 SASI_Mm01_00196500 predicted 1925
4 SASI_Mm01_00196501 predicted 2504
5 SASI_Mm01_00196502 predicted 1079
6 SASI_Mm01_00196503 predicted 1024
7 SASI_Mm01_00196505 predicted 1138
8 SASI_Mm01_00196507 predicted 1817
9 SASI_Mm01_00196508 predicted 1459
10 SASI_Mm02_00336763 predicted 863
11 SASI_Mm01_00196504 predicted 1731
12 SASI_Mm01_00196506 predicted 2474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018657
VALIDATED
MYNN MISSION shRNA Bacterial Glycerol Stock
myoneurin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018657.3-2349s21c1
Sequence:CCGGATTTGAGTTGTGACCATTATTCTCGAGAATAATGGTCACAACTCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018657.3-1919s21c1
Sequence:CCGGGACCATTTATCTGCGAATTATCTCGAGATAATTCGCAGATAAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-732s1c1
Sequence:CCGGCCCAGTGACATCTTAGAGAATCTCGAGATTCTCTAAGATGTCACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018657.2-1426s1c1
Sequence:CCGGCCTATCATGTCCGTAGGCATACTCGAGTATGCCTACGGACATGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-233s1c1
Sequence:CCGGCCAGTTTAAAGCTCATAGGAACTCGAGTTCCTATGAGCTTTAAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-753s1c1
Sequence:CCGGGCATCTGTTGAATTATTCCTACTCGAGTAGGAATAATTCAACAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-1883s1c1
Sequence:CCGGGTCTCCTACATCAGATACATTCTCGAGAATGTATCTGATGTAGGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018657
VALIDATED
MYNN MISSION shRNA shRNA Plasmid DNA
myoneurin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018657.3-2349s21c1
Sequence:CCGGATTTGAGTTGTGACCATTATTCTCGAGAATAATGGTCACAACTCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018657.3-1919s21c1
Sequence:CCGGGACCATTTATCTGCGAATTATCTCGAGATAATTCGCAGATAAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-732s1c1
Sequence:CCGGCCCAGTGACATCTTAGAGAATCTCGAGATTCTCTAAGATGTCACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018657.2-1426s1c1
Sequence:CCGGCCTATCATGTCCGTAGGCATACTCGAGTATGCCTACGGACATGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-233s1c1
Sequence:CCGGCCAGTTTAAAGCTCATAGGAACTCGAGTTCCTATGAGCTTTAAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-753s1c1
Sequence:CCGGGCATCTGTTGAATTATTCCTACTCGAGTAGGAATAATTCAACAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-1883s1c1
Sequence:CCGGGTCTCCTACATCAGATACATTCTCGAGAATGTATCTGATGTAGGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018657
VALIDATED
MYNN MISSION shRNA Lentiviral Transduction Particles
myoneurin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018657.3-2349s21c1
Sequence:CCGGATTTGAGTTGTGACCATTATTCTCGAGAATAATGGTCACAACTCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018657.3-1919s21c1
Sequence:CCGGGACCATTTATCTGCGAATTATCTCGAGATAATTCGCAGATAAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-732s1c1
Sequence:CCGGCCCAGTGACATCTTAGAGAATCTCGAGATTCTCTAAGATGTCACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018657.2-1426s1c1
Sequence:CCGGCCTATCATGTCCGTAGGCATACTCGAGTATGCCTACGGACATGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-233s1c1
Sequence:CCGGCCAGTTTAAAGCTCATAGGAACTCGAGTTCCTATGAGCTTTAAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-753s1c1
Sequence:CCGGGCATCTGTTGAATTATTCCTACTCGAGTAGGAATAATTCAACAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018657.2-1883s1c1
Sequence:CCGGGTCTCCTACATCAGATACATTCTCGAGAATGTATCTGATGTAGGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030557
VALIDATED
MYNN MISSION shRNA Bacterial Glycerol Stock
myoneurin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-950s21c1
Sequence:CCGGGTAGAAGAGGTAGTAACTAAACTCGAGTTTAGTTACTACCTCTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030557.2-1017s21c1
Sequence:CCGGCTACCGAAATATCTAGTATTACTCGAGTAATACTAGATATTTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1296s21c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-3409s21c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1072s21c1
Sequence:CCGGTCTTACCCTGCGAGATTATAACTCGAGTTATAATCTCGCAGGGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-3409s1c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030557.2-935s1c1
Sequence:CCGGGCTGACTATCTCAAAGTAGAACTCGAGTTCTACTTTGAGATAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1296s1c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1301s1c1
Sequence:CCGGCCTGTAGTAGAGCAAATCATTCTCGAGAATGATTTGCTCTACTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-699s1c1
Sequence:CCGGCGGGATTTCTTTGCGACTGTACTCGAGTACAGTCGCAAAGAAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030557
VALIDATED
MYNN MISSION shRNA shRNA Plasmid DNA
myoneurin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-950s21c1
Sequence:CCGGGTAGAAGAGGTAGTAACTAAACTCGAGTTTAGTTACTACCTCTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030557.2-1017s21c1
Sequence:CCGGCTACCGAAATATCTAGTATTACTCGAGTAATACTAGATATTTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1296s21c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-3409s21c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1072s21c1
Sequence:CCGGTCTTACCCTGCGAGATTATAACTCGAGTTATAATCTCGCAGGGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-3409s1c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030557.2-935s1c1
Sequence:CCGGGCTGACTATCTCAAAGTAGAACTCGAGTTCTACTTTGAGATAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1296s1c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1301s1c1
Sequence:CCGGCCTGTAGTAGAGCAAATCATTCTCGAGAATGATTTGCTCTACTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-699s1c1
Sequence:CCGGCGGGATTTCTTTGCGACTGTACTCGAGTACAGTCGCAAAGAAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030557
VALIDATED
MYNN MISSION shRNA Lentiviral Transduction Particles
myoneurin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-950s21c1
Sequence:CCGGGTAGAAGAGGTAGTAACTAAACTCGAGTTTAGTTACTACCTCTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030557.2-1017s21c1
Sequence:CCGGCTACCGAAATATCTAGTATTACTCGAGTAATACTAGATATTTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1296s21c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-3409s21c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030557.2-1072s21c1
Sequence:CCGGTCTTACCCTGCGAGATTATAACTCGAGTTATAATCTCGCAGGGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-3409s1c1
Sequence:CCGGGCAACACACATACACACAAATCTCGAGATTTGTGTGTATGTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030557.2-935s1c1
Sequence:CCGGGCTGACTATCTCAAAGTAGAACTCGAGTTCTACTTTGAGATAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1296s1c1
Sequence:CCGGCCTCACCTGTAGTAGAGCAAACTCGAGTTTGCTCTACTACAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-1301s1c1
Sequence:CCGGCCTGTAGTAGAGCAAATCATTCTCGAGAATGATTTGCTCTACTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030557.2-699s1c1
Sequence:CCGGCGGGATTTCTTTGCGACTGTACTCGAGTACAGTCGCAAAGAAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)