EMAIL THIS PAGE TO A FRIEND

MYO15A

myosin XVA

39 Gene Product Result for
Synonyms: DFNB3 MYO15
UniProtKB ID: Q9UKN7
Gene ID:
Human(51168) Summary: This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Rat(501699) myosin XVA
sheep(101111380) myosin XVA
chicken(101666823) myosin XVA
chicken(101750031) myosin XVA
cow(782104) myosin XVA
Horse(100051916) myosin XVA
dog(479522) myosin XVA
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072131 MISSION® esiRNA esiRNA human MYO15A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016239 Rosetta Predictions human pricing
XM_001077498 Rosetta Predictions rat pricing
XM_577100 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019252 predicted 5139
2 SASI_Hs01_00019254 predicted 1400
3 SASI_Hs02_00349111 predicted 10237
4 SASI_Hs01_00019255 predicted 1352
5 SASI_Hs01_00019257 predicted 8403
6 SASI_Hs01_00019258 predicted 8590
7 SASI_Hs01_00019259 predicted 10650
8 SASI_Hs01_00019260 predicted 8942
9 SASI_Hs01_00019261 predicted 6478
10 SASI_Hs02_00349112 predicted 5294
11 SASI_Hs01_00019253 predicted 10256
12 SASI_Hs01_00019256 predicted 9537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357285 predicted 9545
2 SASI_Rn02_00357286 predicted 6458
3 SASI_Rn02_00357287 predicted 3727
4 SASI_Rn02_00357288 predicted 9320
5 SASI_Rn02_00357289 predicted 3115
6 SASI_Rn02_00357290 predicted 4869
7 SASI_Rn02_00357291 predicted 6215
8 SASI_Rn02_00357292 predicted 8676
9 SASI_Rn02_00357293 predicted 3849
10 SASI_Rn02_00357294 predicted 3129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406163 predicted 9543
2 SASI_Rn02_00406164 predicted 6453
3 SASI_Rn02_00406165 predicted 3724
4 SASI_Rn02_00406166 predicted 9322
5 SASI_Rn02_00406167 predicted 3109
6 SASI_Rn02_00406168 predicted 4866
7 SASI_Rn02_00406169 predicted 6217
8 SASI_Rn02_00406170 predicted 3849
9 SASI_Rn02_00406171 predicted 3132
10 SASI_Rn02_00406172 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016239
MYO15A MISSION shRNA Bacterial Glycerol Stock
myosin XVA
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016239.2-11414s1c1
Sequence:CCGGCTTTGGTTATTTCTGTGCAAACTCGAGTTTGCACAGAAATAACCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-9363s1c1
Sequence:CCGGCCCTACACAATGCTCGAGTTTCTCGAGAAACTCGAGCATTGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-8052s1c1
Sequence:CCGGCCCACACAGCAGATCAAGAATCTCGAGATTCTTGATCTGCTGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-1425s1c1
Sequence:CCGGCCCTACGATGTACCCTACTTTCTCGAGAAAGTAGGGTACATCGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-5144s1c1
Sequence:CCGGGCTGTGTATTAACTACGCAAACTCGAGTTTGCGTAGTTAATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4258s21c1
Sequence:CCGGAGAACCAGTGCATAATCATTACTCGAGTAATGATTATGCACTGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4056s21c1
Sequence:CCGGTCCAACCTCAAGATTAGATTTCTCGAGAAATCTAATCTTGAGGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-5765s21c1
Sequence:CCGGAGATGTGGTAATGGCACAATTCTCGAGAATTGTGCCATTACCACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016239
MYO15A MISSION shRNA shRNA Plasmid DNA
myosin XVA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016239.2-11414s1c1
Sequence:CCGGCTTTGGTTATTTCTGTGCAAACTCGAGTTTGCACAGAAATAACCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-9363s1c1
Sequence:CCGGCCCTACACAATGCTCGAGTTTCTCGAGAAACTCGAGCATTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-8052s1c1
Sequence:CCGGCCCACACAGCAGATCAAGAATCTCGAGATTCTTGATCTGCTGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-1425s1c1
Sequence:CCGGCCCTACGATGTACCCTACTTTCTCGAGAAAGTAGGGTACATCGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-5144s1c1
Sequence:CCGGGCTGTGTATTAACTACGCAAACTCGAGTTTGCGTAGTTAATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4258s21c1
Sequence:CCGGAGAACCAGTGCATAATCATTACTCGAGTAATGATTATGCACTGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4056s21c1
Sequence:CCGGTCCAACCTCAAGATTAGATTTCTCGAGAAATCTAATCTTGAGGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-5765s21c1
Sequence:CCGGAGATGTGGTAATGGCACAATTCTCGAGAATTGTGCCATTACCACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016239
MYO15A MISSION shRNA Lentiviral Transduction Particles
myosin XVA
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016239.2-11414s1c1
Sequence:CCGGCTTTGGTTATTTCTGTGCAAACTCGAGTTTGCACAGAAATAACCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-9363s1c1
Sequence:CCGGCCCTACACAATGCTCGAGTTTCTCGAGAAACTCGAGCATTGTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-8052s1c1
Sequence:CCGGCCCACACAGCAGATCAAGAATCTCGAGATTCTTGATCTGCTGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-1425s1c1
Sequence:CCGGCCCTACGATGTACCCTACTTTCTCGAGAAAGTAGGGTACATCGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016239.2-5144s1c1
Sequence:CCGGGCTGTGTATTAACTACGCAAACTCGAGTTTGCGTAGTTAATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4258s21c1
Sequence:CCGGAGAACCAGTGCATAATCATTACTCGAGTAATGATTATGCACTGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-4056s21c1
Sequence:CCGGTCCAACCTCAAGATTAGATTTCTCGAGAAATCTAATCTTGAGGTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016239.3-5765s21c1
Sequence:CCGGAGATGTGGTAATGGCACAATTCTCGAGAATTGTGCCATTACCACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)