EMAIL THIS PAGE TO A FRIEND

MYO15B

myosin XVB pseudogene

189 Gene Product Result for
Synonyms: MYO15BP
UniProtKB ID: Q96JP2
Gene ID:
Mouse(217328) myosin XVB
cow(508470) myosin XVB pseudogene
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_203357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_203357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_203357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097951 MISSION® esiRNA esiRNA human AC087749.12-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003587 Rosetta Predictions human pricing
XM_981684 Rosetta Predictions mouse pricing
XM_989678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379685 predicted 3371
2 SASI_Hs02_00379686 predicted 8520
3 SASI_Hs02_00379687 predicted 2205
4 SASI_Hs02_00379688 predicted 7169
5 SASI_Hs02_00379689 predicted 2364
6 SASI_Hs02_00379690 predicted 6894
7 SASI_Hs02_00379691 predicted 7764
8 SASI_Hs02_00379692 predicted 7333
9 SASI_Hs02_00379693 predicted 6644
10 SASI_Hs02_00379694 predicted 3097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447620 predicted 1266
2 SASI_Mm02_00447621 predicted 1806
3 SASI_Mm02_00447622 predicted 2430
4 SASI_Mm02_00447623 predicted 879
5 SASI_Mm02_00447624 predicted 3470
6 SASI_Mm02_00447625 predicted 1650
7 SASI_Mm02_00447626 predicted 2552
8 SASI_Mm02_00447627 predicted 2615
9 SASI_Mm02_00447628 predicted 1270
10 SASI_Mm02_00447629 predicted 2903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273002 predicted 1590
2 SASI_Mm01_00273003 predicted 2139
3 SASI_Mm01_00273004 predicted 2755
4 SASI_Mm01_00273005 predicted 1666
5 SASI_Mm01_00273006 predicted 221
6 SASI_Mm01_00273007 predicted 1206
7 SASI_Mm01_00273008 predicted 3796
8 SASI_Mm01_00273009 predicted 1979
9 SASI_Mm01_00273010 predicted 2886
10 SASI_Mm01_00273011 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_203357
MYO15B MISSION shRNA Bacterial Glycerol Stock
myosin XVB pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1332s1c1
Sequence:CCGGCGTAGTGCTGAGAGTGAGTAACTCGAGTTACTCACTCTCAGCACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-192s1c1
Sequence:CCGGCCAGATGAGTAGAGACACCAACTCGAGTTGGTGTCTCTACTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1164s1c1
Sequence:CCGGGCTGCTGTCTTATATTCCCAACTCGAGTTGGGAATATAAGACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-228s1c1
Sequence:CCGGCAACCTGATCCAGTACACTAACTCGAGTTAGTGTACTGGATCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-700s1c1
Sequence:CCGGCAAGCAGTTCGTTTGCTTCTACTCGAGTAGAAGCAAACGAACTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_203357
MYO15B MISSION shRNA shRNA Plasmid DNA
myosin XVB pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1332s1c1
Sequence:CCGGCGTAGTGCTGAGAGTGAGTAACTCGAGTTACTCACTCTCAGCACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-192s1c1
Sequence:CCGGCCAGATGAGTAGAGACACCAACTCGAGTTGGTGTCTCTACTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1164s1c1
Sequence:CCGGGCTGCTGTCTTATATTCCCAACTCGAGTTGGGAATATAAGACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-228s1c1
Sequence:CCGGCAACCTGATCCAGTACACTAACTCGAGTTAGTGTACTGGATCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-700s1c1
Sequence:CCGGCAAGCAGTTCGTTTGCTTCTACTCGAGTAGAAGCAAACGAACTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_203357
MYO15B MISSION shRNA Lentiviral Transduction Particles
myosin XVB pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1332s1c1
Sequence:CCGGCGTAGTGCTGAGAGTGAGTAACTCGAGTTACTCACTCTCAGCACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-192s1c1
Sequence:CCGGCCAGATGAGTAGAGACACCAACTCGAGTTGGTGTCTCTACTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-1164s1c1
Sequence:CCGGGCTGCTGTCTTATATTCCCAACTCGAGTTGGGAATATAAGACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-228s1c1
Sequence:CCGGCAACCTGATCCAGTACACTAACTCGAGTTAGTGTACTGGATCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203357.5-700s1c1
Sequence:CCGGCAAGCAGTTCGTTTGCTTCTACTCGAGTAGAAGCAAACGAACTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)