EMAIL THIS PAGE TO A FRIEND

MYO16

myosin XVI

116 Gene Product Result for
Synonyms: MYR8 Myo16b NYAP3
Gene ID:
Mouse(244281) myosin XVI
Rat(192253) myosin XVI
Zebrafish(563752) myosin XVI
dog(485546) myosin XVI
cow(617611) myosin XVI
Horse(100051619) myosin XVI
chicken(418751) myosin XVI
sheep(101115289) myosin XVI
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015011 Rosetta Predictions human pricing
NM_138893 Rosetta Predictions rat pricing
NM_001081397 Rosetta Predictions mouse pricing
XM_977549 Rosetta Predictions mouse pricing
XM_977585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139957 predicted 2975
2 SASI_Hs01_00139958 predicted 2104
3 SASI_Hs01_00139959 predicted 785
4 SASI_Hs01_00139961 predicted 5399
5 SASI_Hs01_00139962 predicted 5185
6 SASI_Hs01_00139963 predicted 2986
7 SASI_Hs01_00139964 predicted 1131
8 SASI_Hs01_00139965 predicted 3392
9 SASI_Hs02_00346780 predicted 1122
10 SASI_Hs02_00346781 predicted 3254
11 SASI_Hs01_00139960 predicted 910
12 SASI_Hs01_00139966 predicted 2259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094641 predicted 1969
2 SASI_Rn01_00094642 predicted 519
3 SASI_Rn01_00094643 predicted 2200
4 SASI_Rn01_00094644 predicted 1734
5 SASI_Rn01_00094645 predicted 5011
6 SASI_Rn01_00094646 predicted 3570
7 SASI_Rn01_00094647 predicted 5768
8 SASI_Rn01_00094648 predicted 2041
9 SASI_Rn01_00094649 predicted 5355
10 SASI_Rn01_00094650 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298001 predicted 5590
2 SASI_Mm02_00298002 predicted 5909
3 SASI_Mm02_00298003 predicted 3571
4 SASI_Mm02_00298004 predicted 2542
5 SASI_Mm02_00298005 predicted 2490
6 SASI_Mm02_00298006 predicted 3806
7 SASI_Mm02_00298007 predicted 1698
8 SASI_Mm02_00298008 predicted 3886
9 SASI_Mm02_00298009 predicted 2521
10 SASI_Mm02_00298010 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263610 predicted 461
2 SASI_Mm01_00263611 predicted 845
3 SASI_Mm01_00263612 predicted 1728
4 SASI_Mm01_00263613 predicted 852
5 SASI_Mm01_00263614 predicted 1715
6 SASI_Mm01_00263615 predicted 1474
7 SASI_Mm01_00263616 predicted 1656
8 SASI_Mm01_00263617 predicted 1070
9 SASI_Mm01_00263618 predicted 1843
10 SASI_Mm01_00263619 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253923 predicted 448
2 SASI_Mm01_00253924 predicted 832
3 SASI_Mm01_00253925 predicted 1716
4 SASI_Mm01_00253926 predicted 842
5 SASI_Mm01_00253927 predicted 1704
6 SASI_Mm01_00253928 predicted 1267
7 SASI_Mm01_00253929 predicted 1462
8 SASI_Mm01_00253930 predicted 1644
9 SASI_Mm01_00253931 predicted 1061
10 SASI_Mm01_00253932 predicted 1833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015011
MYO16 MISSION shRNA Bacterial Glycerol Stock
myosin XVI
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-529s1c1
Sequence:CCGGGCCTGCGATAACCCTGATATTCTCGAGAATATCAGGGTTATCGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-1775s1c1
Sequence:CCGGCCAGTTGCTTCATCAAGTATTCTCGAGAATACTTGATGAAGCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-430s1c1
Sequence:CCGGCGGTATGATAATGCCTTCATTCTCGAGAATGAAGGCATTATCATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015011.1-6313s1c1
Sequence:CCGGCGCACCTAAATCTTGAAACTACTCGAGTAGTTTCAAGATTTAGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-3778s21c1
Sequence:CCGGATGAACGCTCCCTACCATAAACTCGAGTTTATGGTAGGGAGCGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-5333s21c1
Sequence:CCGGATTCACTATCTAGTGCTATAACTCGAGTTATAGCACTAGATAGTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015011
MYO16 MISSION shRNA shRNA Plasmid DNA
myosin XVI
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-529s1c1
Sequence:CCGGGCCTGCGATAACCCTGATATTCTCGAGAATATCAGGGTTATCGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-1775s1c1
Sequence:CCGGCCAGTTGCTTCATCAAGTATTCTCGAGAATACTTGATGAAGCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-430s1c1
Sequence:CCGGCGGTATGATAATGCCTTCATTCTCGAGAATGAAGGCATTATCATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015011.1-6313s1c1
Sequence:CCGGCGCACCTAAATCTTGAAACTACTCGAGTAGTTTCAAGATTTAGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-3778s21c1
Sequence:CCGGATGAACGCTCCCTACCATAAACTCGAGTTTATGGTAGGGAGCGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-5333s21c1
Sequence:CCGGATTCACTATCTAGTGCTATAACTCGAGTTATAGCACTAGATAGTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015011
MYO16 MISSION shRNA Lentiviral Transduction Particles
myosin XVI
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-529s1c1
Sequence:CCGGGCCTGCGATAACCCTGATATTCTCGAGAATATCAGGGTTATCGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-1775s1c1
Sequence:CCGGCCAGTTGCTTCATCAAGTATTCTCGAGAATACTTGATGAAGCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015011.1-430s1c1
Sequence:CCGGCGGTATGATAATGCCTTCATTCTCGAGAATGAAGGCATTATCATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015011.1-6313s1c1
Sequence:CCGGCGCACCTAAATCTTGAAACTACTCGAGTAGTTTCAAGATTTAGGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-3778s21c1
Sequence:CCGGATGAACGCTCCCTACCATAAACTCGAGTTTATGGTAGGGAGCGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015011.1-5333s21c1
Sequence:CCGGATTCACTATCTAGTGCTATAACTCGAGTTATAGCACTAGATAGTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081397
MYO16 MISSION shRNA Bacterial Glycerol Stock
myosin XVI
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-3693s21c1
Sequence:CCGGCTTGTTCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGAACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081397.1-6106s21c1
Sequence:CCGGACAGGACACTAACGATGACTACTCGAGTAGTCATCGTTAGTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-2662s21c1
Sequence:CCGGGCCTACAGACATTGGATATTGCTCGAGCAATATCCAATGTCTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1268s21c1
Sequence:CCGGGATGTTGCTGAAAGCCGAAATCTCGAGATTTCGGCTTTCAGCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1941s21c1
Sequence:CCGGAGACTCAGGCATGCCATATACCTCGAGGTATATGGCATGCCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081397
MYO16 MISSION shRNA shRNA Plasmid DNA
myosin XVI
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-3693s21c1
Sequence:CCGGCTTGTTCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGAACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081397.1-6106s21c1
Sequence:CCGGACAGGACACTAACGATGACTACTCGAGTAGTCATCGTTAGTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-2662s21c1
Sequence:CCGGGCCTACAGACATTGGATATTGCTCGAGCAATATCCAATGTCTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1268s21c1
Sequence:CCGGGATGTTGCTGAAAGCCGAAATCTCGAGATTTCGGCTTTCAGCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1941s21c1
Sequence:CCGGAGACTCAGGCATGCCATATACCTCGAGGTATATGGCATGCCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081397
MYO16 MISSION shRNA Lentiviral Transduction Particles
myosin XVI
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-3693s21c1
Sequence:CCGGCTTGTTCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGAACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081397.1-6106s21c1
Sequence:CCGGACAGGACACTAACGATGACTACTCGAGTAGTCATCGTTAGTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-2662s21c1
Sequence:CCGGGCCTACAGACATTGGATATTGCTCGAGCAATATCCAATGTCTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1268s21c1
Sequence:CCGGGATGTTGCTGAAAGCCGAAATCTCGAGATTTCGGCTTTCAGCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081397.1-1941s21c1
Sequence:CCGGAGACTCAGGCATGCCATATACCTCGAGGTATATGGCATGCCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)