EMAIL THIS PAGE TO A FRIEND

MYO18A

myosin XVIIIA

88 Gene Product Result for
Synonyms: MYSPDZ SPR210
UniProtKB ID: Q92614, Q5H9U3, Q5W9F9, Q5W9G1, Q8IXP8
Gene ID:
Mouse(360013) myosin XVIIIA
Rat(360570) myosin XVIIIa
chicken(417581) myosin XVIIIA
dog(480630) myosin XVIIIA
Horse(100059638) myosin XVIIIA
cow(519634) myosin XVIIIA
domestic cat(101093974) myosin XVIIIA
sheep(101121529) myosin XVIIIA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_078471 Rosetta Predictions human pricing
NM_203318 Rosetta Predictions human pricing
XM_001080824 Rosetta Predictions rat pricing
XM_340847 Rosetta Predictions rat pricing
NM_011586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224320 predicted 5494
2 SASI_Hs01_00224321 predicted 545
3 SASI_Hs02_00362154 predicted 5414
4 SASI_Hs01_00224322 predicted 3546
5 SASI_Hs02_00362155 predicted 3467
6 SASI_Hs02_00362156 predicted 4723
7 SASI_Hs02_00362157 predicted 4205
8 SASI_Hs02_00362158 predicted 4760
9 SASI_Hs02_00362159 predicted 4305
10 SASI_Hs02_00362160 predicted 2920
11 SASI_Hs01_00224313 predicted 6479
12 SASI_Hs01_00224314 predicted 6678
13 SASI_Hs01_00224315 predicted 6517
14 SASI_Hs01_00224316 predicted 6439
15 SASI_Hs01_00224317 predicted 6468
16 SASI_Hs01_00224318 predicted 6570
17 SASI_Hs01_00224319 predicted 6568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210027 predicted 5503
2 SASI_Hs01_00210028 predicted 547
3 SASI_Hs02_00373253 predicted 5411
4 SASI_Hs01_00210029 predicted 3555
5 SASI_Hs02_00373254 predicted 3467
6 SASI_Hs02_00373255 predicted 4729
7 SASI_Hs02_00373256 predicted 4206
8 SASI_Hs02_00373257 predicted 4756
9 SASI_Hs02_00373258 predicted 4308
10 SASI_Hs02_00373259 predicted 2918
11 SASI_Hs01_00210020 predicted 6434
12 SASI_Hs01_00210021 predicted 6633
13 SASI_Hs01_00210022 predicted 6477
14 SASI_Hs01_00210023 predicted 6388
15 SASI_Hs01_00210024 predicted 6421
16 SASI_Hs01_00210025 predicted 6515
17 SASI_Hs01_00210026 predicted 6523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369528 predicted 2967
2 SASI_Rn02_00369529 predicted 2037
3 SASI_Rn02_00369530 predicted 1733
4 SASI_Rn02_00369531 predicted 4219
5 SASI_Rn02_00369532 predicted 2228
6 SASI_Rn02_00369533 predicted 1611
7 SASI_Rn02_00369534 predicted 524
8 SASI_Rn02_00369535 predicted 1022
9 SASI_Rn02_00369536 predicted 1611
10 SASI_Rn02_00369537 predicted 2438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176377 predicted 4965
2 SASI_Rn01_00176378 predicted 1236
3 SASI_Rn01_00176379 predicted 5700
4 SASI_Rn01_00176380 predicted 276
5 SASI_Rn01_00176381 predicted 771
6 SASI_Rn01_00176382 predicted 8904
7 SASI_Rn01_00176383 predicted 2929
8 SASI_Rn01_00176384 predicted 4614
9 SASI_Rn01_00176385 predicted 6265
10 SASI_Rn01_00176386 predicted 4222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092707 predicted 1235
2 SASI_Mm01_00092708 predicted 791
3 SASI_Mm01_00092710 predicted 901
4 SASI_Mm01_00092711 predicted 4090
5 SASI_Mm01_00092712 predicted 1185
6 SASI_Mm01_00092713 predicted 1284
7 SASI_Mm01_00092714 predicted 5792
8 SASI_Mm01_00092715 predicted 1499
9 SASI_Mm01_00092716 predicted 4280
10 SASI_Mm02_00320981 predicted 3346
11 SASI_Mm01_00092709 predicted 5049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078471
VALIDATED
MYO18A MISSION shRNA Bacterial Glycerol Stock
myosin XVIIIA
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-396s21c1
Sequence:CCGGGACATTGACTCCGATAGTAACCTCGAGGTTACTATCGGAGTCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-978s21c1
Sequence:CCGGGATCGACTGGTGGAGATTAATCTCGAGATTAATCTCCACCAGTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-1339s21c1
Sequence:CCGGATGACGTTGAGAAGGCTAATGCTCGAGCATTAGCCTTCTCAACGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-201s1c1
Sequence:CCGGCGGAAGGAGAAGAAGGAGAAACTCGAGTTTCTCCTTCTTCTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-4157s1c1
Sequence:CCGGCGATGCACTGAAGAAGCAGATCTCGAGATCTGCTTCTTCAGTGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-2993s1c1
Sequence:CCGGGCTGAACTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-6147s1c1
Sequence:CCGGGCTTCTGATGATGGCAGCTTACTCGAGTAAGCTGCCATCATCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-5426s1c1
Sequence:CCGGCGAATTGATGAAGAAGCACAACTCGAGTTGTGCTTCTTCATCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078471
VALIDATED
MYO18A MISSION shRNA shRNA Plasmid DNA
myosin XVIIIA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-396s21c1
Sequence:CCGGGACATTGACTCCGATAGTAACCTCGAGGTTACTATCGGAGTCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-978s21c1
Sequence:CCGGGATCGACTGGTGGAGATTAATCTCGAGATTAATCTCCACCAGTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-1339s21c1
Sequence:CCGGATGACGTTGAGAAGGCTAATGCTCGAGCATTAGCCTTCTCAACGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-201s1c1
Sequence:CCGGCGGAAGGAGAAGAAGGAGAAACTCGAGTTTCTCCTTCTTCTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-4157s1c1
Sequence:CCGGCGATGCACTGAAGAAGCAGATCTCGAGATCTGCTTCTTCAGTGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-2993s1c1
Sequence:CCGGGCTGAACTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-6147s1c1
Sequence:CCGGGCTTCTGATGATGGCAGCTTACTCGAGTAAGCTGCCATCATCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-5426s1c1
Sequence:CCGGCGAATTGATGAAGAAGCACAACTCGAGTTGTGCTTCTTCATCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078471
VALIDATED
MYO18A MISSION shRNA Lentiviral Transduction Particles
myosin XVIIIA
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-396s21c1
Sequence:CCGGGACATTGACTCCGATAGTAACCTCGAGGTTACTATCGGAGTCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-978s21c1
Sequence:CCGGGATCGACTGGTGGAGATTAATCTCGAGATTAATCTCCACCAGTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078471.3-1339s21c1
Sequence:CCGGATGACGTTGAGAAGGCTAATGCTCGAGCATTAGCCTTCTCAACGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-201s1c1
Sequence:CCGGCGGAAGGAGAAGAAGGAGAAACTCGAGTTTCTCCTTCTTCTCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-4157s1c1
Sequence:CCGGCGATGCACTGAAGAAGCAGATCTCGAGATCTGCTTCTTCAGTGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-2993s1c1
Sequence:CCGGGCTGAACTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-6147s1c1
Sequence:CCGGGCTTCTGATGATGGCAGCTTACTCGAGTAAGCTGCCATCATCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_078471.3-5426s1c1
Sequence:CCGGCGAATTGATGAAGAAGCACAACTCGAGTTGTGCTTCTTCATCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011586
VALIDATED
MYO18A MISSION shRNA Bacterial Glycerol Stock
myosin XVIIIA
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-6846s21c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-3095s21c1
Sequence:CCGGAGTCGCTGTGCATACAGATTACTCGAGTAATCTGTATGCACAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-5046s21c1
Sequence:CCGGGATCATGCTGGACCACTTAAACTCGAGTTTAAGTGGTCCAGCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011586.2-2874s21c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-4974s21c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6845s1c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6049s1c1
Sequence:CCGGCCATCGGATGATGAGCATGATCTCGAGATCATGCTCATCATCCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-4974s1c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-2874s1c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011586.1-2080s1c1
Sequence:CCGGGCTACCAAAGAAGCTGCTGAACTCGAGTTCAGCAGCTTCTTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011586
VALIDATED
MYO18A MISSION shRNA shRNA Plasmid DNA
myosin XVIIIA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-6846s21c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-3095s21c1
Sequence:CCGGAGTCGCTGTGCATACAGATTACTCGAGTAATCTGTATGCACAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-5046s21c1
Sequence:CCGGGATCATGCTGGACCACTTAAACTCGAGTTTAAGTGGTCCAGCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011586.2-2874s21c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-4974s21c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6845s1c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6049s1c1
Sequence:CCGGCCATCGGATGATGAGCATGATCTCGAGATCATGCTCATCATCCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-4974s1c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-2874s1c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011586.1-2080s1c1
Sequence:CCGGGCTACCAAAGAAGCTGCTGAACTCGAGTTCAGCAGCTTCTTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011586
VALIDATED
MYO18A MISSION shRNA Lentiviral Transduction Particles
myosin XVIIIA
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-6846s21c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-3095s21c1
Sequence:CCGGAGTCGCTGTGCATACAGATTACTCGAGTAATCTGTATGCACAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-5046s21c1
Sequence:CCGGGATCATGCTGGACCACTTAAACTCGAGTTTAAGTGGTCCAGCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011586.2-2874s21c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011586.2-4974s21c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6845s1c1
Sequence:CCGGCGTTAGAGTATTAAGTGCAATCTCGAGATTGCACTTAATACTCTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-6049s1c1
Sequence:CCGGCCATCGGATGATGAGCATGATCTCGAGATCATGCTCATCATCCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-4974s1c1
Sequence:CCGGGCGGGACTTTGAATCAGAGAACTCGAGTTCTCTGATTCAAAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011586.1-2874s1c1
Sequence:CCGGGCTGAATTACACCAAGCAGAACTCGAGTTCTGCTTGGTGTAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011586.1-2080s1c1
Sequence:CCGGGCTACCAAAGAAGCTGCTGAACTCGAGTTCAGCAGCTTCTTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)