EMAIL THIS PAGE TO A FRIEND

MYO18B

myosin XVIIIB

77 Gene Product Result for
Gene ID:
Human(84700) Summary: The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
Mouse(74376) myosin XVIIIb
Rat(304551) myosin XVIIIb
chicken(416905) myosin XVIIIB
dog(486328) myosin XVIIIB
Horse(100059514) myosin XVIIIB
domestic cat(101083461) myosin XVIIIB
cow(540437) myosin XVIIIB
sheep(101117620) myosin XVIIIB
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_620246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_620246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_620246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032608 Rosetta Predictions human pricing
XM_239684 Rosetta Predictions rat pricing
XR_009380 Rosetta Predictions rat pricing
XM_912851 Rosetta Predictions mouse pricing
XM_990203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184343 predicted 4519
2 SASI_Hs01_00184344 predicted 4942
3 SASI_Hs01_00184345 predicted 2583
4 SASI_Hs01_00184346 predicted 6522
5 SASI_Hs01_00184347 predicted 3177
6 SASI_Hs02_00360163 predicted 6830
7 SASI_Hs01_00184348 predicted 7649
8 SASI_Hs01_00184350 predicted 6654
9 SASI_Hs01_00184351 predicted 1497
10 SASI_Hs02_00360164 predicted 4474
11 SASI_Hs01_00184342 predicted 2511
12 SASI_Hs01_00184349 predicted 7305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391534 predicted 652
2 SASI_Rn02_00391535 predicted 2902
3 SASI_Rn02_00391536 predicted 982
4 SASI_Rn02_00391537 predicted 518
5 SASI_Rn02_00391538 predicted 1272
6 SASI_Rn02_00391539 predicted 2789
7 SASI_Rn02_00391540 predicted 3716
8 SASI_Rn02_00391541 predicted 2791
9 SASI_Rn02_00391542 predicted 5940
10 SASI_Rn02_00391543 predicted 2491
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419541 predicted 646
2 SASI_Rn02_00419542 predicted 2904
3 SASI_Rn02_00419543 predicted 977
4 SASI_Rn02_00419544 predicted 515
5 SASI_Rn02_00419545 predicted 1273
6 SASI_Rn02_00419546 predicted 2781
7 SASI_Rn02_00419547 predicted 3713
8 SASI_Rn02_00419548 predicted 2794
9 SASI_Rn02_00419549 predicted 5933
10 SASI_Rn02_00419550 predicted 2496
11 SASI_Rn01_00174376 predicted 7223
12 SASI_Rn01_00174377 predicted 7309
13 SASI_Rn01_00174378 predicted 7260
14 SASI_Rn01_00174379 predicted 7314
15 SASI_Rn01_00174380 predicted 7388
16 SASI_Rn01_00174381 predicted 7303
17 SASI_Rn01_00174382 predicted 7390
18 SASI_Rn01_00174383 predicted 7254
19 SASI_Rn01_00174384 predicted 7245
20 SASI_Rn01_00174385 predicted 7240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437341 predicted 7638
2 SASI_Mm02_00437342 predicted 7220
3 SASI_Mm02_00437343 predicted 4743
4 SASI_Mm02_00437344 predicted 5386
5 SASI_Mm02_00437345 predicted 3111
6 SASI_Mm02_00437346 predicted 5004
7 SASI_Mm02_00437347 predicted 6007
8 SASI_Mm02_00437348 predicted 6299
9 SASI_Mm02_00437349 predicted 1816
10 SASI_Mm02_00437350 predicted 3326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248713 predicted 2593
2 SASI_Mm01_00248715 predicted 2607
3 SASI_Mm01_00248716 predicted 2905
4 SASI_Mm01_00248717 predicted 2824
5 SASI_Mm01_00248718 predicted 671
6 SASI_Mm01_00248719 predicted 1531
7 SASI_Mm01_00248720 predicted 3040
8 SASI_Mm02_00450198 predicted 1450
9 SASI_Mm02_00450199 predicted 227
10 SASI_Mm01_00248722 predicted 2527
11 SASI_Mm01_00248714 predicted 2966
12 SASI_Mm01_00248721 predicted 1684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_620246
MYO18B MISSION shRNA Bacterial Glycerol Stock
myosin XVIIIB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_620246.1-2325s1c1
Sequence:CCGGACTCCAAAGCACTGGAGAGAACTCGAGTTCTCTCCAGTGCTTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-502s1c1
Sequence:CCGGCCTGGAGAACAAGACCGAATTCTCGAGAATTCGGTCTTGTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-220s1c1
Sequence:CCGGGCAACTGTACAGGTTGCAGTTCTCGAGAACTGCAACCTGTACAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-2234s1c1
Sequence:CCGGGACGACGATGTGGAAAGCATACTCGAGTATGCTTTCCACATCGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-1883s1c1
Sequence:CCGGCAGACCAAAGTGGACTTTGATCTCGAGATCAAAGTCCACTTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_620246
MYO18B MISSION shRNA shRNA Plasmid DNA
myosin XVIIIB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_620246.1-2325s1c1
Sequence:CCGGACTCCAAAGCACTGGAGAGAACTCGAGTTCTCTCCAGTGCTTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-502s1c1
Sequence:CCGGCCTGGAGAACAAGACCGAATTCTCGAGAATTCGGTCTTGTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-220s1c1
Sequence:CCGGGCAACTGTACAGGTTGCAGTTCTCGAGAACTGCAACCTGTACAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-2234s1c1
Sequence:CCGGGACGACGATGTGGAAAGCATACTCGAGTATGCTTTCCACATCGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-1883s1c1
Sequence:CCGGCAGACCAAAGTGGACTTTGATCTCGAGATCAAAGTCCACTTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_620246
MYO18B MISSION shRNA Lentiviral Transduction Particles
myosin XVIIIB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_620246.1-2325s1c1
Sequence:CCGGACTCCAAAGCACTGGAGAGAACTCGAGTTCTCTCCAGTGCTTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-502s1c1
Sequence:CCGGCCTGGAGAACAAGACCGAATTCTCGAGAATTCGGTCTTGTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-220s1c1
Sequence:CCGGGCAACTGTACAGGTTGCAGTTCTCGAGAACTGCAACCTGTACAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-2234s1c1
Sequence:CCGGGACGACGATGTGGAAAGCATACTCGAGTATGCTTTCCACATCGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_620246.1-1883s1c1
Sequence:CCGGCAGACCAAAGTGGACTTTGATCTCGAGATCAAAGTCCACTTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032608
MYO18B MISSION shRNA Bacterial Glycerol Stock
myosin XVIIIB
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032608.5-8364s1c1
Sequence:CCGGCCAGGAAGTCTTTCCTGATATCTCGAGATATCAGGAAAGACTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-1270s1c1
Sequence:CCGGGCTCTTAAGTAAGGCAGAGAACTCGAGTTCTCTGCCTTACTTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7912s1c1
Sequence:CCGGCGACGATGTTGCGAGCATAATCTCGAGATTATGCTCGCAACATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7221s1c1
Sequence:CCGGCCAGCCTCAAATGCATCTCTTCTCGAGAAGAGATGCATTTGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-801s1c1
Sequence:CCGGCCACAGATACTGGAAAGGAAACTCGAGTTTCCTTTCCAGTATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-3203s21c1
Sequence:CCGGGTCTCCACGCTACAGCGATATCTCGAGATATCGCTGTAGCGTGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-1822s21c1
Sequence:CCGGTACTCTTGCTACGGTGCTAAACTCGAGTTTAGCACCGTAGCAAGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-5238s21c1
Sequence:CCGGAGATGCTACAGGACCATAAACCTCGAGGTTTATGGTCCTGTAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032608
MYO18B MISSION shRNA shRNA Plasmid DNA
myosin XVIIIB
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032608.5-8364s1c1
Sequence:CCGGCCAGGAAGTCTTTCCTGATATCTCGAGATATCAGGAAAGACTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-1270s1c1
Sequence:CCGGGCTCTTAAGTAAGGCAGAGAACTCGAGTTCTCTGCCTTACTTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7912s1c1
Sequence:CCGGCGACGATGTTGCGAGCATAATCTCGAGATTATGCTCGCAACATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7221s1c1
Sequence:CCGGCCAGCCTCAAATGCATCTCTTCTCGAGAAGAGATGCATTTGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-801s1c1
Sequence:CCGGCCACAGATACTGGAAAGGAAACTCGAGTTTCCTTTCCAGTATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-3203s21c1
Sequence:CCGGGTCTCCACGCTACAGCGATATCTCGAGATATCGCTGTAGCGTGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-1822s21c1
Sequence:CCGGTACTCTTGCTACGGTGCTAAACTCGAGTTTAGCACCGTAGCAAGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-5238s21c1
Sequence:CCGGAGATGCTACAGGACCATAAACCTCGAGGTTTATGGTCCTGTAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032608
MYO18B MISSION shRNA Lentiviral Transduction Particles
myosin XVIIIB
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032608.5-8364s1c1
Sequence:CCGGCCAGGAAGTCTTTCCTGATATCTCGAGATATCAGGAAAGACTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-1270s1c1
Sequence:CCGGGCTCTTAAGTAAGGCAGAGAACTCGAGTTCTCTGCCTTACTTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7912s1c1
Sequence:CCGGCGACGATGTTGCGAGCATAATCTCGAGATTATGCTCGCAACATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-7221s1c1
Sequence:CCGGCCAGCCTCAAATGCATCTCTTCTCGAGAAGAGATGCATTTGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032608.5-801s1c1
Sequence:CCGGCCACAGATACTGGAAAGGAAACTCGAGTTTCCTTTCCAGTATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-3203s21c1
Sequence:CCGGGTCTCCACGCTACAGCGATATCTCGAGATATCGCTGTAGCGTGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-1822s21c1
Sequence:CCGGTACTCTTGCTACGGTGCTAAACTCGAGTTTAGCACCGTAGCAAGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032608.5-5238s21c1
Sequence:CCGGAGATGCTACAGGACCATAAACCTCGAGGTTTATGGTCCTGTAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)