EMAIL THIS PAGE TO A FRIEND

MYO19

myosin XIX

68 Gene Product Result for
Synonyms: MYOHD1
UniProtKB ID: Q96H55, Q59GS4, Q9H5X2
Gene ID:
Mouse(66196) myosin XIX
Rat(497974) myosin XIX
sheep(101109982) myosin XIX
chicken(417649) myosin XIX
dog(491128) myosin XIX
cow(508229) myosin XIX
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033579 Rosetta Predictions human pricing
NM_001033580 Rosetta Predictions human pricing
NM_025109 Rosetta Predictions human pricing
XM_001081070 Rosetta Predictions rat pricing
XM_573168 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106696 predicted 555
2 SASI_Hs01_00106697 predicted 1046
3 SASI_Hs01_00106698 predicted 607
4 SASI_Hs01_00106699 predicted 986
5 SASI_Hs01_00106700 predicted 836
6 SASI_Hs01_00106701 predicted 911
7 SASI_Hs01_00106702 predicted 955
8 SASI_Hs01_00106703 predicted 561
9 SASI_Hs01_00106704 predicted 473
10 SASI_Hs01_00106705 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215317 predicted 557
2 SASI_Hs01_00215318 predicted 1034
3 SASI_Hs01_00215319 predicted 597
4 SASI_Hs01_00215320 predicted 983
5 SASI_Hs01_00215321 predicted 838
6 SASI_Hs01_00215322 predicted 911
7 SASI_Hs01_00215323 predicted 950
8 SASI_Hs01_00215324 predicted 554
9 SASI_Hs01_00215325 predicted 466
10 SASI_Hs01_00215326 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159093 predicted 547
2 SASI_Hs01_00159094 predicted 1036
3 SASI_Hs01_00159095 predicted 604
4 SASI_Hs01_00159096 predicted 981
5 SASI_Hs01_00159097 predicted 836
6 SASI_Hs01_00159098 predicted 907
7 SASI_Hs01_00159099 predicted 947
8 SASI_Hs01_00159100 predicted 555
9 SASI_Hs01_00159101 predicted 467
10 SASI_Hs01_00159102 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370454 predicted 1759
2 SASI_Rn02_00370455 predicted 801
3 SASI_Rn02_00370456 predicted 3149
4 SASI_Rn02_00370457 predicted 2309
5 SASI_Rn02_00370458 predicted 2719
6 SASI_Rn02_00370459 predicted 1014
7 SASI_Rn02_00370460 predicted 1728
8 SASI_Rn02_00370461 predicted 1476
9 SASI_Rn02_00370462 predicted 3303
10 SASI_Rn02_00370463 predicted 3178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399924 predicted 1757
2 SASI_Rn02_00399925 predicted 795
3 SASI_Rn02_00399926 predicted 3146
4 SASI_Rn02_00399927 predicted 2316
5 SASI_Rn02_00399928 predicted 2714
6 SASI_Rn02_00399929 predicted 1009
7 SASI_Rn02_00399930 predicted 1723
8 SASI_Rn02_00399931 predicted 1472
9 SASI_Rn02_00399932 predicted 3307
10 SASI_Rn02_00399933 predicted 3178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025109
MYO19 MISSION shRNA Bacterial Glycerol Stock
myosin XIX
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2203s21c1
Sequence:CCGGACTCGTGGACCACTTTCATAGCTCGAGCTATGAAAGTGGTCCACGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2137s21c1
Sequence:CCGGTGATCTATGCGCGGTTGTTTGCTCGAGCAAACAACCGCGCATAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-1545s21c1
Sequence:CCGGGCGTGTACACTGAGGAATAACCTCGAGGTTATTCCTCAGTGTACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2235s21c1
Sequence:CCGGGTGTATGGATTTGAATCATTTCTCGAGAAATGATTCAAATCCATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-3219s21c1
Sequence:CCGGTACAGCATTACAGGCTTTAATCTCGAGATTAAAGCCTGTAATGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-1801s1c1
Sequence:CCGGGAAGGCTTCATCCTTGCACATCTCGAGATGTGCAAGGATGAAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-747s1c1
Sequence:CCGGGAACCAGTCAACCAGTCTATTCTCGAGAATAGACTGGTTGACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-2909s1c1
Sequence:CCGGGTAGTTACCAAATCAGGGTTACTCGAGTAACCCTGATTTGGTAACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-3012s1c1
Sequence:CCGGCCAATTCCACATAAGCACTTTCTCGAGAAAGTGCTTATGTGGAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-2545s1c1
Sequence:CCGGCGATAAAGTTTCACTGCAGAACTCGAGTTCTGCAGTGAAACTTTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-1769s1c1
Sequence:CCGGCCGAAACTTTGTAGAACGATACTCGAGTATCGTTCTACAAAGTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-750s1c1
Sequence:CCGGCCAGTCAACCAGTCTATTGTTCTCGAGAACAATAGACTGGTTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025109
MYO19 MISSION shRNA shRNA Plasmid DNA
myosin XIX
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2203s21c1
Sequence:CCGGACTCGTGGACCACTTTCATAGCTCGAGCTATGAAAGTGGTCCACGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2137s21c1
Sequence:CCGGTGATCTATGCGCGGTTGTTTGCTCGAGCAAACAACCGCGCATAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-1545s21c1
Sequence:CCGGGCGTGTACACTGAGGAATAACCTCGAGGTTATTCCTCAGTGTACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2235s21c1
Sequence:CCGGGTGTATGGATTTGAATCATTTCTCGAGAAATGATTCAAATCCATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-3219s21c1
Sequence:CCGGTACAGCATTACAGGCTTTAATCTCGAGATTAAAGCCTGTAATGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-1801s1c1
Sequence:CCGGGAAGGCTTCATCCTTGCACATCTCGAGATGTGCAAGGATGAAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-747s1c1
Sequence:CCGGGAACCAGTCAACCAGTCTATTCTCGAGAATAGACTGGTTGACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-2909s1c1
Sequence:CCGGGTAGTTACCAAATCAGGGTTACTCGAGTAACCCTGATTTGGTAACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-3012s1c1
Sequence:CCGGCCAATTCCACATAAGCACTTTCTCGAGAAAGTGCTTATGTGGAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-2545s1c1
Sequence:CCGGCGATAAAGTTTCACTGCAGAACTCGAGTTCTGCAGTGAAACTTTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-1769s1c1
Sequence:CCGGCCGAAACTTTGTAGAACGATACTCGAGTATCGTTCTACAAAGTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-750s1c1
Sequence:CCGGCCAGTCAACCAGTCTATTGTTCTCGAGAACAATAGACTGGTTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025109
MYO19 MISSION shRNA Lentiviral Transduction Particles
myosin XIX
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2203s21c1
Sequence:CCGGACTCGTGGACCACTTTCATAGCTCGAGCTATGAAAGTGGTCCACGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2137s21c1
Sequence:CCGGTGATCTATGCGCGGTTGTTTGCTCGAGCAAACAACCGCGCATAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-1545s21c1
Sequence:CCGGGCGTGTACACTGAGGAATAACCTCGAGGTTATTCCTCAGTGTACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-2235s21c1
Sequence:CCGGGTGTATGGATTTGAATCATTTCTCGAGAAATGATTCAAATCCATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025109.5-3219s21c1
Sequence:CCGGTACAGCATTACAGGCTTTAATCTCGAGATTAAAGCCTGTAATGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-1801s1c1
Sequence:CCGGGAAGGCTTCATCCTTGCACATCTCGAGATGTGCAAGGATGAAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025109.3-747s1c1
Sequence:CCGGGAACCAGTCAACCAGTCTATTCTCGAGAATAGACTGGTTGACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-2909s1c1
Sequence:CCGGGTAGTTACCAAATCAGGGTTACTCGAGTAACCCTGATTTGGTAACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025109.3-3012s1c1
Sequence:CCGGCCAATTCCACATAAGCACTTTCTCGAGAAAGTGCTTATGTGGAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-2545s1c1
Sequence:CCGGCGATAAAGTTTCACTGCAGAACTCGAGTTCTGCAGTGAAACTTTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-1769s1c1
Sequence:CCGGCCGAAACTTTGTAGAACGATACTCGAGTATCGTTCTACAAAGTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025109.3-750s1c1
Sequence:CCGGCCAGTCAACCAGTCTATTGTTCTCGAGAACAATAGACTGGTTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025414
MYO19 MISSION shRNA Bacterial Glycerol Stock
myosin XIX
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025414.3-3409s21c1
Sequence:CCGGCACGCAAGTGCCAAGCTATTCCTCGAGGAATAGCTTGGCACTTGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025414.2-2496s1c1
Sequence:CCGGGCTTAGTATCTTTGTGCTCAACTCGAGTTGAGCACAAAGATACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1519s1c1
Sequence:CCGGCCCGGCTAAGAACACACAAATCTCGAGATTTGTGTGTTCTTAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1736s1c1
Sequence:CCGGCGGAAACACATCAGAAGGTTACTCGAGTAACCTTCTGATGTGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1324s1c1
Sequence:CCGGCCAGAACTTCATAGAAAGATACTCGAGTATCTTTCTATGAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1220s1c1
Sequence:CCGGCCACAGACTTTCCTCCAAGAACTCGAGTTCTTGGAGGAAAGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025414
MYO19 MISSION shRNA shRNA Plasmid DNA
myosin XIX
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025414.3-3409s21c1
Sequence:CCGGCACGCAAGTGCCAAGCTATTCCTCGAGGAATAGCTTGGCACTTGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025414.2-2496s1c1
Sequence:CCGGGCTTAGTATCTTTGTGCTCAACTCGAGTTGAGCACAAAGATACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1519s1c1
Sequence:CCGGCCCGGCTAAGAACACACAAATCTCGAGATTTGTGTGTTCTTAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1736s1c1
Sequence:CCGGCGGAAACACATCAGAAGGTTACTCGAGTAACCTTCTGATGTGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1324s1c1
Sequence:CCGGCCAGAACTTCATAGAAAGATACTCGAGTATCTTTCTATGAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1220s1c1
Sequence:CCGGCCACAGACTTTCCTCCAAGAACTCGAGTTCTTGGAGGAAAGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025414
MYO19 MISSION shRNA Lentiviral Transduction Particles
myosin XIX
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025414.3-3409s21c1
Sequence:CCGGCACGCAAGTGCCAAGCTATTCCTCGAGGAATAGCTTGGCACTTGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025414.2-2496s1c1
Sequence:CCGGGCTTAGTATCTTTGTGCTCAACTCGAGTTGAGCACAAAGATACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1519s1c1
Sequence:CCGGCCCGGCTAAGAACACACAAATCTCGAGATTTGTGTGTTCTTAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1736s1c1
Sequence:CCGGCGGAAACACATCAGAAGGTTACTCGAGTAACCTTCTGATGTGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1324s1c1
Sequence:CCGGCCAGAACTTCATAGAAAGATACTCGAGTATCTTTCTATGAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025414.2-1220s1c1
Sequence:CCGGCCACAGACTTTCCTCCAAGAACTCGAGTTCTTGGAGGAAAGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)