EMAIL THIS PAGE TO A FRIEND

MYO1A

myosin IA

76 Gene Product Result for
Synonyms: BBMI DFNA48 MIHC MYHL
UniProtKB ID: Q9UBC5, Q9UQD7
Gene ID:
Human(4640) Summary: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(432516) myosin IA
Rat(299509) myosin IA
chicken(396072) myosin IA
dog(474410) myosin IA
cow(281936) myosin IA
Horse(100052722) myosin IA
sheep(101102890) myosin IA
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005379 Rosetta Predictions human pricing
XM_001056742 Rosetta Predictions rat pricing
XM_238479 Rosetta Predictions rat pricing
NM_001081219 Rosetta Predictions mouse pricing
XM_483962 Rosetta Predictions mouse pricing
XM_899448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147842 predicted 1984
2 SASI_Hs01_00147843 predicted 1760
3 SASI_Hs02_00339487 predicted 2520
4 SASI_Hs02_00339488 predicted 694
5 SASI_Hs01_00147846 predicted 1577
6 SASI_Hs01_00147848 predicted 1358
7 SASI_Hs01_00147849 predicted 1522
8 SASI_Hs01_00147850 predicted 351
9 SASI_Hs01_00147851 predicted 898
10 SASI_Hs02_00339489 predicted 995
11 SASI_Hs01_00147844 predicted 317
12 SASI_Hs01_00147845 predicted 2404
13 SASI_Hs01_00147847 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284261 predicted 1587
2 SASI_Rn02_00284262 predicted 883
3 SASI_Rn02_00284263 predicted 950
4 SASI_Rn02_00284264 predicted 2923
5 SASI_Rn02_00284265 predicted 1297
6 SASI_Rn02_00284266 predicted 463
7 SASI_Rn02_00284267 predicted 1569
8 SASI_Rn02_00284268 predicted 293
9 SASI_Rn02_00284269 predicted 708
10 SASI_Rn02_00284270 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391356 predicted 216
2 SASI_Rn02_00391357 predicted 206
3 SASI_Rn02_00391358 predicted 248
4 SASI_Rn02_00391359 predicted 241
5 SASI_Rn02_00391360 predicted 261
6 SASI_Rn02_00391361 predicted 212
7 SASI_Rn02_00391362 predicted 194
8 SASI_Rn02_00391363 predicted 276
9 SASI_Rn02_00391364 predicted 263
10 SASI_Rn02_00391365 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296351 predicted 1070
2 SASI_Mm02_00296352 predicted 1535
3 SASI_Mm02_00296353 predicted 1381
4 SASI_Mm02_00296354 predicted 1164
5 SASI_Mm02_00296355 predicted 2760
6 SASI_Mm02_00296356 predicted 451
7 SASI_Mm02_00296357 predicted 1279
8 SASI_Mm02_00296358 predicted 232
9 SASI_Mm02_00296359 predicted 1434
10 SASI_Mm02_00296360 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247435 predicted 1076
2 SASI_Mm01_00247436 predicted 1534
3 SASI_Mm01_00247437 predicted 331
4 SASI_Mm01_00247438 predicted 1001
5 SASI_Mm01_00247439 predicted 1388
6 SASI_Mm01_00247440 predicted 1167
7 SASI_Mm01_00247441 predicted 457
8 SASI_Mm01_00247442 predicted 1282
9 SASI_Mm01_00247443 predicted 238
10 SASI_Mm01_00247444 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262473 predicted 311
2 SASI_Mm01_00262474 predicted 308
3 SASI_Mm01_00262475 predicted 310
4 SASI_Mm01_00262476 predicted 290
5 SASI_Mm01_00262477 predicted 323
6 SASI_Mm01_00262478 predicted 291
7 SASI_Mm01_00262479 predicted 287
8 SASI_Mm01_00262480 predicted 313
9 SASI_Mm01_00262481 predicted 307
10 SASI_Mm01_00262482 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005379
MYO1A MISSION shRNA Bacterial Glycerol Stock
myosin IA
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005379.2-3408s1c1
Sequence:CCGGTCCTCCTGAACCAGCACTAATCTCGAGATTAGTGCTGGTTCAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-1990s1c1
Sequence:CCGGCCCAACTACATCAGGTGCATACTCGAGTATGCACCTGATGTAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2520s1c1
Sequence:CCGGCCGAAAGAATTATCGCAAATACTCGAGTATTTGCGATAATTCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2518s1c1
Sequence:CCGGGCCCGAAAGAATTATCGCAAACTCGAGTTTGCGATAATTCTTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-765s1c1
Sequence:CCGGCGGTGGTGTCATCACAAACTACTCGAGTAGTTTGTGATGACACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-1706s21c1
Sequence:CCGGAGAATGCCCAGCGTCAGTATGCTCGAGCATACTGACGCTGGGCATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-2627s21c1
Sequence:CCGGTGCCATCCACAAACGTCTTAGCTCGAGCTAAGACGTTTGTGGATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005379
MYO1A MISSION shRNA shRNA Plasmid DNA
myosin IA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005379.2-3408s1c1
Sequence:CCGGTCCTCCTGAACCAGCACTAATCTCGAGATTAGTGCTGGTTCAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-1990s1c1
Sequence:CCGGCCCAACTACATCAGGTGCATACTCGAGTATGCACCTGATGTAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2520s1c1
Sequence:CCGGCCGAAAGAATTATCGCAAATACTCGAGTATTTGCGATAATTCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2518s1c1
Sequence:CCGGGCCCGAAAGAATTATCGCAAACTCGAGTTTGCGATAATTCTTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-765s1c1
Sequence:CCGGCGGTGGTGTCATCACAAACTACTCGAGTAGTTTGTGATGACACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-1706s21c1
Sequence:CCGGAGAATGCCCAGCGTCAGTATGCTCGAGCATACTGACGCTGGGCATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-2627s21c1
Sequence:CCGGTGCCATCCACAAACGTCTTAGCTCGAGCTAAGACGTTTGTGGATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005379
MYO1A MISSION shRNA Lentiviral Transduction Particles
myosin IA
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005379.2-3408s1c1
Sequence:CCGGTCCTCCTGAACCAGCACTAATCTCGAGATTAGTGCTGGTTCAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-1990s1c1
Sequence:CCGGCCCAACTACATCAGGTGCATACTCGAGTATGCACCTGATGTAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2520s1c1
Sequence:CCGGCCGAAAGAATTATCGCAAATACTCGAGTATTTGCGATAATTCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-2518s1c1
Sequence:CCGGGCCCGAAAGAATTATCGCAAACTCGAGTTTGCGATAATTCTTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005379.2-765s1c1
Sequence:CCGGCGGTGGTGTCATCACAAACTACTCGAGTAGTTTGTGATGACACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-1706s21c1
Sequence:CCGGAGAATGCCCAGCGTCAGTATGCTCGAGCATACTGACGCTGGGCATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005379.2-2627s21c1
Sequence:CCGGTGCCATCCACAAACGTCTTAGCTCGAGCTAAGACGTTTGTGGATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081219
MYO1A MISSION shRNA Bacterial Glycerol Stock
myosin IA
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-524s21c1
Sequence:CCGGGCGGTGTCATCACCAACTATCCTCGAGGATAGTTGGTGATGACACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-654s21c1
Sequence:CCGGTGAGGAGGACACGAGTGTATACTCGAGTATACACTCGTGTCCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-1435s21c1
Sequence:CCGGCACAGTCACTACGAGAGTAAACTCGAGTTTACTCTCGTAGTGACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-185s21c1
Sequence:CCGGTTGCCAAATACCGGGACTATACTCGAGTATAGTCCCGGTATTTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081219.2-3181s21c1
Sequence:CCGGTTCGTAGTGTCTCACTCTTCTCTCGAGAGAAGAGTGAGACACTACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081219
MYO1A MISSION shRNA shRNA Plasmid DNA
myosin IA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-524s21c1
Sequence:CCGGGCGGTGTCATCACCAACTATCCTCGAGGATAGTTGGTGATGACACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-654s21c1
Sequence:CCGGTGAGGAGGACACGAGTGTATACTCGAGTATACACTCGTGTCCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-1435s21c1
Sequence:CCGGCACAGTCACTACGAGAGTAAACTCGAGTTTACTCTCGTAGTGACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-185s21c1
Sequence:CCGGTTGCCAAATACCGGGACTATACTCGAGTATAGTCCCGGTATTTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081219.2-3181s21c1
Sequence:CCGGTTCGTAGTGTCTCACTCTTCTCTCGAGAGAAGAGTGAGACACTACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081219
MYO1A MISSION shRNA Lentiviral Transduction Particles
myosin IA
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-524s21c1
Sequence:CCGGGCGGTGTCATCACCAACTATCCTCGAGGATAGTTGGTGATGACACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-654s21c1
Sequence:CCGGTGAGGAGGACACGAGTGTATACTCGAGTATACACTCGTGTCCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-1435s21c1
Sequence:CCGGCACAGTCACTACGAGAGTAAACTCGAGTTTACTCTCGTAGTGACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081219.2-185s21c1
Sequence:CCGGTTGCCAAATACCGGGACTATACTCGAGTATAGTCCCGGTATTTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081219.2-3181s21c1
Sequence:CCGGTTCGTAGTGTCTCACTCTTCTCTCGAGAGAAGAGTGAGACACTACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)