EMAIL THIS PAGE TO A FRIEND

MYO1C

myosin IC

89 Gene Product Result for
Synonyms: MMI-beta MMIb NMI myr2
UniProtKB ID: O00159, Q4LE56, Q6NVJ7, Q86Y95
Gene ID:
Human(4641) Summary: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. The mouse ortholog of this protein also functions in intracellular vesicle transport to the plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. The related gene myosin IE has been referred to as myosin IC in the literature, but it is a distinct locus on chromosome 19. [provided by RefSeq, Jul 2008]
Mouse(17913) myosin IC
Rat(65261) myosin IC
Zebrafish(566459) myosin IC
cow(281937) myosin IC
chicken(417555) myosin IC
dog(480646) myosin IC
sheep(101102997) myosin IC
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084721 MISSION® esiRNA esiRNA human MYO1C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080779 Rosetta Predictions human pricing
NM_001080950 Rosetta Predictions human pricing
NM_033375 Rosetta Predictions human pricing
NM_023092 Rosetta Predictions rat pricing
NM_001080774 Rosetta Predictions mouse pricing
NM_001080775 Rosetta Predictions mouse pricing
NM_008659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315970 predicted 1950
2 SASI_Hs02_00315971 predicted 2452
3 SASI_Hs02_00315972 predicted 3390
4 SASI_Hs02_00315973 predicted 1762
5 SASI_Hs02_00315974 predicted 1368
6 SASI_Hs02_00315975 predicted 561
7 SASI_Hs02_00315976 predicted 1953
8 SASI_Hs02_00315977 predicted 1952
9 SASI_Hs02_00315978 predicted 2471
10 SASI_Hs02_00315979 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316167 predicted 1725
2 SASI_Hs02_00316168 predicted 2223
3 SASI_Hs02_00316169 predicted 3160
4 SASI_Hs02_00316170 predicted 1529
5 SASI_Hs02_00316171 predicted 1138
6 SASI_Hs02_00316172 predicted 334
7 SASI_Hs02_00316173 predicted 1724
8 SASI_Hs02_00316174 predicted 1719
9 SASI_Hs02_00316175 predicted 2240
10 SASI_Hs02_00316176 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073794 predicted 1742
2 SASI_Hs02_00361222 predicted 2234
3 SASI_Hs01_00073795 predicted 3175
4 SASI_Hs01_00073796 predicted 1548
5 SASI_Hs01_00073797 predicted 1147
6 SASI_Hs01_00073798 predicted 348
7 SASI_Hs02_00361223 predicted 1733
8 SASI_Hs02_00361224 predicted 1737
9 SASI_Hs01_00073800 predicted 2249
10 SASI_Hs01_00073801 predicted 2135
11 SASI_Hs01_00073793 predicted 2842
12 SASI_Hs01_00073799 predicted 2870
13 SASI_Hs01_00073802 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043337 predicted 1147
2 SASI_Rn02_00263723 predicted 3021
3 SASI_Rn01_00043338 predicted 2004
4 SASI_Rn01_00043339 predicted 3056
5 SASI_Rn01_00043340 predicted 2513
6 SASI_Rn02_00263724 predicted 3335
7 SASI_Rn01_00043343 predicted 2019
8 SASI_Rn01_00043344 predicted 435
9 SASI_Rn01_00043345 predicted 1702
10 SASI_Rn01_00043346 predicted 1261
11 SASI_Rn01_00043341 predicted 1727
12 SASI_Rn01_00043342 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293703 predicted 1957
2 SASI_Mm02_00293704 predicted 1108
3 SASI_Mm02_00293705 predicted 394
4 SASI_Mm02_00293706 predicted 2255
5 SASI_Mm02_00293707 predicted 2958
6 SASI_Mm02_00293708 predicted 3006
7 SASI_Mm02_00293709 predicted 3017
8 SASI_Mm02_00293710 predicted 3161
9 SASI_Mm02_00293711 predicted 2362
10 SASI_Mm02_00293712 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293713 predicted 1954
2 SASI_Mm02_00293714 predicted 1094
3 SASI_Mm02_00293715 predicted 393
4 SASI_Mm02_00293716 predicted 2244
5 SASI_Mm02_00293717 predicted 2949
6 SASI_Mm02_00293718 predicted 3006
7 SASI_Mm02_00293719 predicted 3012
8 SASI_Mm02_00293720 predicted 3161
9 SASI_Mm02_00293721 predicted 2363
10 SASI_Mm02_00293722 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185404 predicted 1929
2 SASI_Mm01_00185405 predicted 1069
3 SASI_Mm01_00185406 predicted 363
4 SASI_Mm01_00185407 predicted 2211
5 SASI_Mm01_00185408 predicted 2920
6 SASI_Mm01_00185409 predicted 2972
7 SASI_Mm01_00185410 predicted 2979
8 SASI_Mm01_00185411 predicted 3130
9 SASI_Mm01_00185412 predicted 2328
10 SASI_Mm01_00185413 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008659
VALIDATED
MYO1C MISSION shRNA Bacterial Glycerol Stock
myosin IC
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-4248s1c1
Sequence:CCGGCGACCCAATTTAAGAATGGTACTCGAGTACCATTCTTAAATTGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2976s1c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2005s1c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-3056s1c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008659.2-2896s1c1
Sequence:CCGGGAATTGATTATGCCAACCTAACTCGAGTTAGGTTGGCATAATCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008659.3-3516s21c1
Sequence:CCGGCCCTCTGCTGATGCCAAATATCTCGAGATATTTGGCATCAGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3035s21c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-2064s21c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3115s21c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008659
VALIDATED
MYO1C MISSION shRNA shRNA Plasmid DNA
myosin IC
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-4248s1c1
Sequence:CCGGCGACCCAATTTAAGAATGGTACTCGAGTACCATTCTTAAATTGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2976s1c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2005s1c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-3056s1c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008659.2-2896s1c1
Sequence:CCGGGAATTGATTATGCCAACCTAACTCGAGTTAGGTTGGCATAATCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008659.3-3516s21c1
Sequence:CCGGCCCTCTGCTGATGCCAAATATCTCGAGATATTTGGCATCAGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3035s21c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-2064s21c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3115s21c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008659
VALIDATED
MYO1C MISSION shRNA Lentiviral Transduction Particles
myosin IC
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-4248s1c1
Sequence:CCGGCGACCCAATTTAAGAATGGTACTCGAGTACCATTCTTAAATTGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2976s1c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-2005s1c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008659.2-3056s1c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008659.2-2896s1c1
Sequence:CCGGGAATTGATTATGCCAACCTAACTCGAGTTAGGTTGGCATAATCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008659.3-3516s21c1
Sequence:CCGGCCCTCTGCTGATGCCAAATATCTCGAGATATTTGGCATCAGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3035s21c1
Sequence:CCGGGACAACAAGCAGAAGGGAGATCTCGAGATCTCCCTTCTGCTTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-2064s21c1
Sequence:CCGGGCTTTGCCTATCGTCGCAAATCTCGAGATTTGCGACGATAGGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008659.3-3115s21c1
Sequence:CCGGCCGCGTGAACAATATCAACATCTCGAGATGTTGATATTGTTCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033375
MYO1C MISSION shRNA Bacterial Glycerol Stock
myosin IC
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1937s1c1
Sequence:CCGGTGTAGCTCAAAGAATCCCATTCTCGAGAATGGGATTCTTTGAGCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1952s1c1
Sequence:CCGGCCCATTATGAGCCAGTGCTTTCTCGAGAAAGCACTGGCTCATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-3082s1c1
Sequence:CCGGGCAGAGGATTGATTACGCCAACTCGAGTTGGCGTAATCAATCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033375.3-3990s1c1
Sequence:CCGGCCCTTCTTTCTGCCTTAAGAACTCGAGTTCTTAAGGCAGAAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1621s1c1
Sequence:CCGGGCCCGTCCAGTATTTCAACAACTCGAGTTGTTGAAATACTGGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033375
MYO1C MISSION shRNA shRNA Plasmid DNA
myosin IC
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1937s1c1
Sequence:CCGGTGTAGCTCAAAGAATCCCATTCTCGAGAATGGGATTCTTTGAGCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1952s1c1
Sequence:CCGGCCCATTATGAGCCAGTGCTTTCTCGAGAAAGCACTGGCTCATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-3082s1c1
Sequence:CCGGGCAGAGGATTGATTACGCCAACTCGAGTTGGCGTAATCAATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033375.3-3990s1c1
Sequence:CCGGCCCTTCTTTCTGCCTTAAGAACTCGAGTTCTTAAGGCAGAAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1621s1c1
Sequence:CCGGGCCCGTCCAGTATTTCAACAACTCGAGTTGTTGAAATACTGGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033375
MYO1C MISSION shRNA Lentiviral Transduction Particles
myosin IC
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1937s1c1
Sequence:CCGGTGTAGCTCAAAGAATCCCATTCTCGAGAATGGGATTCTTTGAGCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1952s1c1
Sequence:CCGGCCCATTATGAGCCAGTGCTTTCTCGAGAAAGCACTGGCTCATAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-3082s1c1
Sequence:CCGGGCAGAGGATTGATTACGCCAACTCGAGTTGGCGTAATCAATCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033375.3-3990s1c1
Sequence:CCGGCCCTTCTTTCTGCCTTAAGAACTCGAGTTCTTAAGGCAGAAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033375.3-1621s1c1
Sequence:CCGGGCCCGTCCAGTATTTCAACAACTCGAGTTGTTGAAATACTGGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)