EMAIL THIS PAGE TO A FRIEND

MYO1D

myosin ID

113 Gene Product Result for
Synonyms: myr4
UniProtKB ID: O94832, A6H8V3, Q8NHP9
Gene ID:
Mouse(338367) myosin ID
Rat(25485) myosin ID
sheep(101115139) myosin ID
chicken(419963) myosin ID
cow(522967) myosin ID
dog(491153) myosin ID
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015194 Rosetta Predictions human pricing
NM_012983 Rosetta Predictions rat pricing
NM_177390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037600 predicted 2195
2 SASI_Hs01_00037601 predicted 534
3 SASI_Hs01_00037602 predicted 265
4 SASI_Hs01_00037603 predicted 2710
5 SASI_Hs01_00037604 predicted 1795
6 SASI_Hs02_00347263 predicted 730
7 SASI_Hs01_00037605 predicted 2675
8 SASI_Hs01_00037606 predicted 1192
9 SASI_Hs01_00037607 predicted 2738
10 SASI_Hs02_00347264 predicted 1219
11 SASI_Hs01_00037599 predicted 807
12 SASI_Hs01_00037608 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094390 predicted 1858
2 SASI_Rn01_00094391 predicted 2682
3 SASI_Rn01_00094392 predicted 2745
4 SASI_Rn01_00094393 predicted 3130
5 SASI_Rn01_00094394 predicted 416
6 SASI_Rn01_00094395 predicted 2037
7 SASI_Rn01_00094396 predicted 1526
8 SASI_Rn01_00094397 predicted 2447
9 SASI_Rn01_00094398 predicted 2348
10 SASI_Rn02_00260605 predicted 2666
11 SASI_Rn01_00094399 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170743 predicted 2415
2 SASI_Mm01_00170744 predicted 493
3 SASI_Mm01_00170745 predicted 1717
4 SASI_Mm01_00170746 predicted 2763
5 SASI_Mm02_00347578 predicted 3204
6 SASI_Mm02_00347579 predicted 2931
7 SASI_Mm01_00170747 predicted 2423
8 SASI_Mm01_00170748 predicted 2745
9 SASI_Mm02_00347580 predicted 2955
10 SASI_Mm02_00347581 predicted 630
11 SASI_Mm01_00170749 predicted 2705
12 SASI_Mm01_00170750 predicted 1612
13 SASI_Mm01_00170751 predicted 1293
14 SASI_Mm01_00170752 predicted 1736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015194
VALIDATED
MYO1D MISSION shRNA Bacterial Glycerol Stock
myosin ID
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-159s21c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-4788s21c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-1377s21c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2758s21c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2600s21c1
Sequence:CCGGTCCGTAAGGTAAATCGATTTACTCGAGTAAATCGATTTACCTTACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-1377s1c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-4788s1c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-159s1c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-2758s1c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015194.1-162s1c1
Sequence:CCGGCCCTTACAAGTTGTTGAACATCTCGAGATGTTCAACAACTTGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015194
VALIDATED
MYO1D MISSION shRNA shRNA Plasmid DNA
myosin ID
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-159s21c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-4788s21c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-1377s21c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2758s21c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2600s21c1
Sequence:CCGGTCCGTAAGGTAAATCGATTTACTCGAGTAAATCGATTTACCTTACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-1377s1c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-4788s1c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-159s1c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-2758s1c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015194.1-162s1c1
Sequence:CCGGCCCTTACAAGTTGTTGAACATCTCGAGATGTTCAACAACTTGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015194
VALIDATED
MYO1D MISSION shRNA Lentiviral Transduction Particles
myosin ID
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-159s21c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-4788s21c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-1377s21c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2758s21c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015194.1-2600s21c1
Sequence:CCGGTCCGTAAGGTAAATCGATTTACTCGAGTAAATCGATTTACCTTACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-1377s1c1
Sequence:CCGGCCTTGATGATGCTTGCATGAACTCGAGTTCATGCAAGCATCATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-4788s1c1
Sequence:CCGGCCAAATGAGTTGCCTGTCAAACTCGAGTTTGACAGGCAACTCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-159s1c1
Sequence:CCGGGAACCCTTACAAGTTGTTGAACTCGAGTTCAACAACTTGTAAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015194.1-2758s1c1
Sequence:CCGGCTTGTAGTGTTCCATACGAAACTCGAGTTTCGTATGGAACACTACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015194.1-162s1c1
Sequence:CCGGCCCTTACAAGTTGTTGAACATCTCGAGATGTTCAACAACTTGTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177390
VALIDATED
MYO1D MISSION shRNA Bacterial Glycerol Stock
myosin ID
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177390.2-2930s1c1
Sequence:CCGGCCACTGTACAACATCAGCCATCTCGAGATGGCTGATGTTGTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1833s1c1
Sequence:CCGGCCTTATGTATAACAGCTCAAACTCGAGTTTGAGCTGTTATACATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1832s1c1
Sequence:CCGGGCCTTATGTATAACAGCTCAACTCGAGTTGAGCTGTTATACATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1098s1c1
Sequence:CCGGGCCGCTTATTGAGAATGGCAACTCGAGTTGCCATTCTCAATAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1609s1c1
Sequence:CCGGGCGTGTATGAATGTTGGCAAACTCGAGTTTGCCAACATTCATACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177390
VALIDATED
MYO1D MISSION shRNA shRNA Plasmid DNA
myosin ID
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177390.2-2930s1c1
Sequence:CCGGCCACTGTACAACATCAGCCATCTCGAGATGGCTGATGTTGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1833s1c1
Sequence:CCGGCCTTATGTATAACAGCTCAAACTCGAGTTTGAGCTGTTATACATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1832s1c1
Sequence:CCGGGCCTTATGTATAACAGCTCAACTCGAGTTGAGCTGTTATACATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1098s1c1
Sequence:CCGGGCCGCTTATTGAGAATGGCAACTCGAGTTGCCATTCTCAATAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1609s1c1
Sequence:CCGGGCGTGTATGAATGTTGGCAAACTCGAGTTTGCCAACATTCATACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177390
VALIDATED
MYO1D MISSION shRNA Lentiviral Transduction Particles
myosin ID
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177390.2-2930s1c1
Sequence:CCGGCCACTGTACAACATCAGCCATCTCGAGATGGCTGATGTTGTACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1833s1c1
Sequence:CCGGCCTTATGTATAACAGCTCAAACTCGAGTTTGAGCTGTTATACATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1832s1c1
Sequence:CCGGGCCTTATGTATAACAGCTCAACTCGAGTTGAGCTGTTATACATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1098s1c1
Sequence:CCGGGCCGCTTATTGAGAATGGCAACTCGAGTTGCCATTCTCAATAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177390.2-1609s1c1
Sequence:CCGGGCGTGTATGAATGTTGGCAAACTCGAGTTTGCCAACATTCATACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)