EMAIL THIS PAGE TO A FRIEND

MYO1E

myosin IE

187 Gene Product Result for
Synonyms: FSGS6 HuncM-IC MYO1C
UniProtKB ID: Q12965, Q14778
Gene ID:
Human(4643) Summary: This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
Mouse(71602) myosin IE
Rat(25484) myosin IE
chicken(415398) myosin IE
cow(523485) myosin IE
Horse(100068162) myosin IE
dog(478325) myosin IE
sheep(101115463) myosin IE
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004998 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004998 Rosetta Predictions human pricing
NM_173101 Rosetta Predictions rat pricing
NM_181072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036396 predicted 2036
2 SASI_Hs01_00036397 predicted 2440
3 SASI_Hs01_00036398 predicted 2189
4 SASI_Hs01_00036399 predicted 538
5 SASI_Hs01_00036400 predicted 672
6 SASI_Hs01_00036401 predicted 3190
7 SASI_Hs01_00036402 predicted 1863
8 SASI_Hs02_00338736 predicted 1245
9 SASI_Hs02_00338737 predicted 1801
10 SASI_Hs02_00338738 predicted 1650
11 SASI_Hs01_00036403 predicted 2820
12 SASI_Hs01_00036404 predicted 2685
13 SASI_Hs01_00036405 predicted 2955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080751 predicted 3501
2 SASI_Rn01_00080752 predicted 1815
3 SASI_Rn01_00080753 predicted 1866
4 SASI_Rn01_00080754 predicted 2230
5 SASI_Rn01_00080755 predicted 452
6 SASI_Rn01_00080756 predicted 2891
7 SASI_Rn01_00080757 predicted 3086
8 SASI_Rn01_00080758 predicted 2590
9 SASI_Rn01_00080759 predicted 405
10 SASI_Rn01_00080760 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031763 predicted 1840
2 SASI_Mm01_00031764 predicted 521
3 SASI_Mm01_00031765 predicted 3561
4 SASI_Mm01_00031766 predicted 2959
5 SASI_Mm02_00349637 predicted 2147
6 SASI_Mm02_00349638 predicted 470
7 SASI_Mm01_00031768 predicted 1933
8 SASI_Mm01_00031770 predicted 493
9 SASI_Mm01_00031771 predicted 1276
10 SASI_Mm01_00031772 predicted 3544
11 SASI_Mm01_00031767 predicted 2206
12 SASI_Mm01_00031769 predicted 1081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004998
VALIDATED
MYO1E MISSION shRNA Bacterial Glycerol Stock
myosin IE
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-1297s1c1
Sequence:CCGGCCTGCATATCTGCTAGGGATACTCGAGTATCCCTAGCAGATATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1459s1c1
Sequence:CCGGCGGGTCTTTGATTTCTTGGTACTCGAGTACCAAGAAATCAAAGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-495s1c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-3588s1c1
Sequence:CCGGCAGCTTTAATGCCAATGACATCTCGAGATGTCATTGGCATTAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-1719s1c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-695s1c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-2971s1c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-2507s1c1
Sequence:CCGGCCCGGAAGAAATACGTTCAAACTCGAGTTTGAACGTATTTCTTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1155s1c1
Sequence:CCGGCGCCATGAATGTGATTGGGATCTCGAGATCCCAATCACATTCATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-492s21c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-1716s21c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-2968s21c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-692s21c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004998
VALIDATED
MYO1E MISSION shRNA shRNA Plasmid DNA
myosin IE
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-1297s1c1
Sequence:CCGGCCTGCATATCTGCTAGGGATACTCGAGTATCCCTAGCAGATATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1459s1c1
Sequence:CCGGCGGGTCTTTGATTTCTTGGTACTCGAGTACCAAGAAATCAAAGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-495s1c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-3588s1c1
Sequence:CCGGCAGCTTTAATGCCAATGACATCTCGAGATGTCATTGGCATTAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-1719s1c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-695s1c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-2971s1c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-2507s1c1
Sequence:CCGGCCCGGAAGAAATACGTTCAAACTCGAGTTTGAACGTATTTCTTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1155s1c1
Sequence:CCGGCGCCATGAATGTGATTGGGATCTCGAGATCCCAATCACATTCATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-492s21c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-1716s21c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-2968s21c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-692s21c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004998
VALIDATED
MYO1E MISSION shRNA Lentiviral Transduction Particles
myosin IE
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-1297s1c1
Sequence:CCGGCCTGCATATCTGCTAGGGATACTCGAGTATCCCTAGCAGATATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1459s1c1
Sequence:CCGGCGGGTCTTTGATTTCTTGGTACTCGAGTACCAAGAAATCAAAGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-495s1c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-3588s1c1
Sequence:CCGGCAGCTTTAATGCCAATGACATCTCGAGATGTCATTGGCATTAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-1719s1c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004998.1-695s1c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004998.1-2971s1c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-2507s1c1
Sequence:CCGGCCCGGAAGAAATACGTTCAAACTCGAGTTTGAACGTATTTCTTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004998.1-1155s1c1
Sequence:CCGGCGCCATGAATGTGATTGGGATCTCGAGATCCCAATCACATTCATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-492s21c1
Sequence:CCGGGAAGAGATACATGGATGACTACTCGAGTAGTCATCCATGTATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-1716s21c1
Sequence:CCGGCCTCATAGAGAACAAAGTGAACTCGAGTTCACTTTGTTCTCTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-2968s21c1
Sequence:CCGGCAGAAGCAACTACCTCTGAAACTCGAGTTTCAGAGGTAGTTGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004998.2-692s21c1
Sequence:CCGGGCGTCATTATCAGTGGTGAAACTCGAGTTTCACCACTGATAATGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181072
VALIDATED
MYO1E MISSION shRNA Bacterial Glycerol Stock
myosin IE
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-4603s1c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-2862s1c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-3567s1c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-2483s1c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-1131s1c1
Sequence:CCGGCGCCATGAATGTGATTGGAATCTCGAGATTCCAATCACATTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181072.3-4603s21c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-2862s21c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-3567s21c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-1275s21c1
Sequence:CCGGTGCGTATCTGCTGGGTATAAACTCGAGTTTATACCCAGCAGATACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181072.3-2483s21c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181072
VALIDATED
MYO1E MISSION shRNA shRNA Plasmid DNA
myosin IE
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-4603s1c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-2862s1c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-3567s1c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-2483s1c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-1131s1c1
Sequence:CCGGCGCCATGAATGTGATTGGAATCTCGAGATTCCAATCACATTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181072.3-4603s21c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-2862s21c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-3567s21c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-1275s21c1
Sequence:CCGGTGCGTATCTGCTGGGTATAAACTCGAGTTTATACCCAGCAGATACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181072.3-2483s21c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181072
VALIDATED
MYO1E MISSION shRNA Lentiviral Transduction Particles
myosin IE
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-4603s1c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-2862s1c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-3567s1c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181072.3-2483s1c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181072.3-1131s1c1
Sequence:CCGGCGCCATGAATGTGATTGGAATCTCGAGATTCCAATCACATTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181072.3-4603s21c1
Sequence:CCGGCCTCCCTTACTTCCTAAATAACTCGAGTTATTTAGGAAGTAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-2862s21c1
Sequence:CCGGCGAGCAAGAATATGACAGTTTCTCGAGAAACTGTCATATTCTTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-3567s21c1
Sequence:CCGGCGCCAACGATATTATTGATATCTCGAGATATCAATAATATCGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181072.3-1275s21c1
Sequence:CCGGTGCGTATCTGCTGGGTATAAACTCGAGTTTATACCCAGCAGATACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181072.3-2483s21c1
Sequence:CCGGCCCGCAAGAAATATGTTCAAACTCGAGTTTGAACATATTTCTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)