EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164401 MISSION® esiRNA esiRNA targeting mouse Myo1h mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101421 Rosetta Predictions human pricing
XM_972888 Rosetta Predictions mouse pricing
XM_987245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322839 predicted 1075
2 SASI_Hs02_00322840 predicted 2061
3 SASI_Hs02_00322841 predicted 1493
4 SASI_Hs02_00322842 predicted 2698
5 SASI_Hs02_00322843 predicted 2628
6 SASI_Hs02_00322844 predicted 2670
7 SASI_Hs02_00322845 predicted 2280
8 SASI_Hs02_00322846 predicted 2816
9 SASI_Hs02_00322847 predicted 2313
10 SASI_Hs02_00322848 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_972888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205400 predicted 1508
2 SASI_Mm01_00205401 predicted 1109
3 SASI_Mm01_00205402 predicted 556
4 SASI_Mm01_00205403 predicted 1337
5 SASI_Mm02_00444735 predicted 1430
6 SASI_Mm01_00205404 predicted 867
7 SASI_Mm01_00205405 predicted 1815
8 SASI_Mm01_00205406 predicted 1966
9 SASI_Mm01_00205407 predicted 1298
10 SASI_Mm01_00205408 predicted 1849
11 SASI_Mm01_00205409 predicted 2058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449311 predicted 1513
2 SASI_Mm02_00449312 predicted 1103
3 SASI_Mm02_00449313 predicted 1813
4 SASI_Mm02_00449314 predicted 1332
5 SASI_Mm02_00449315 predicted 2895
6 SASI_Mm02_00449316 predicted 869
7 SASI_Mm02_00449317 predicted 1964
8 SASI_Mm02_00449318 predicted 1305
9 SASI_Mm02_00449319 predicted 2967
10 SASI_Mm02_00449320 predicted 2544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164573
MYO1H MISSION shRNA Bacterial Glycerol Stock
myosin IH
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1873s21c1
Sequence:CCGGAGGCGCAAGTACGAGCATTTCCTCGAGGAAATGCTCGTACTTGCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1961s21c1
Sequence:CCGGTCGAGCGGCTGATCAAGTATACTCGAGTATACTTGATCAGCCGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-3000s21c1
Sequence:CCGGAGAGGAAGACCAAGTCTATAACTCGAGTTATAGACTTGGTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-107s21c1
Sequence:CCGGTCCGAGAGAACCTCATCTATACTCGAGTATAGATGAGGTTCTCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164573.1-3284s21c1
Sequence:CCGGCCCTGGTGGAACCCAATTTAGCTCGAGCTAAATTGGGTTCCACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-186s21c1
Sequence:CCGGTGCCAGCCAGATGGAACTTTACTCGAGTAAAGTTCCATCTGGCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164573
MYO1H MISSION shRNA shRNA Plasmid DNA
myosin IH
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1873s21c1
Sequence:CCGGAGGCGCAAGTACGAGCATTTCCTCGAGGAAATGCTCGTACTTGCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1961s21c1
Sequence:CCGGTCGAGCGGCTGATCAAGTATACTCGAGTATACTTGATCAGCCGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-3000s21c1
Sequence:CCGGAGAGGAAGACCAAGTCTATAACTCGAGTTATAGACTTGGTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-107s21c1
Sequence:CCGGTCCGAGAGAACCTCATCTATACTCGAGTATAGATGAGGTTCTCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164573.1-3284s21c1
Sequence:CCGGCCCTGGTGGAACCCAATTTAGCTCGAGCTAAATTGGGTTCCACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-186s21c1
Sequence:CCGGTGCCAGCCAGATGGAACTTTACTCGAGTAAAGTTCCATCTGGCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164573
MYO1H MISSION shRNA Lentiviral Transduction Particles
myosin IH
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1873s21c1
Sequence:CCGGAGGCGCAAGTACGAGCATTTCCTCGAGGAAATGCTCGTACTTGCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-1961s21c1
Sequence:CCGGTCGAGCGGCTGATCAAGTATACTCGAGTATACTTGATCAGCCGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-3000s21c1
Sequence:CCGGAGAGGAAGACCAAGTCTATAACTCGAGTTATAGACTTGGTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-107s21c1
Sequence:CCGGTCCGAGAGAACCTCATCTATACTCGAGTATAGATGAGGTTCTCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164573.1-3284s21c1
Sequence:CCGGCCCTGGTGGAACCCAATTTAGCTCGAGCTAAATTGGGTTCCACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164573.1-186s21c1
Sequence:CCGGTGCCAGCCAGATGGAACTTTACTCGAGTAAAGTTCCATCTGGCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173597
MYO1H MISSION shRNA Bacterial Glycerol Stock
myosin IH
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-543s1c1
Sequence:CCGGCAAAGGTAAGAAGTGGGCAATCTCGAGATTGCCCACTTCTTACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-465s1c1
Sequence:CCGGGCAACTCATTCTTACTCAGAACTCGAGTTCTGAGTAAGAATGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-358s1c1
Sequence:CCGGGAAGGAGACATTAATCCGAAACTCGAGTTTCGGATTAATGTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-385s1c1
Sequence:CCGGCAGCTAATTAGCCATGAGAAACTCGAGTTTCTCATGGCTAATTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-373s1c1
Sequence:CCGGCCGAAAGTGCTTCAGCTAATTCTCGAGAATTAGCTGAAGCACTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1387s1c1
Sequence:CCGGGCTGGTTAAGAAGGAGAACATCTCGAGATGTTCTCCTTCTTAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-349s1c1
Sequence:CCGGCGGATAGATGAAGGAGACATTCTCGAGAATGTCTCCTTCATCTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1835s1c1
Sequence:CCGGGCTCCGTATAATCTCACCTTTCTCGAGAAAGGTGAGATTATACGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-534s1c1
Sequence:CCGGCTCAGCTCTCAAAGGTAAGAACTCGAGTTCTTACCTTTGAGAGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173597
MYO1H MISSION shRNA shRNA Plasmid DNA
myosin IH
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-543s1c1
Sequence:CCGGCAAAGGTAAGAAGTGGGCAATCTCGAGATTGCCCACTTCTTACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-465s1c1
Sequence:CCGGGCAACTCATTCTTACTCAGAACTCGAGTTCTGAGTAAGAATGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-358s1c1
Sequence:CCGGGAAGGAGACATTAATCCGAAACTCGAGTTTCGGATTAATGTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-385s1c1
Sequence:CCGGCAGCTAATTAGCCATGAGAAACTCGAGTTTCTCATGGCTAATTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-373s1c1
Sequence:CCGGCCGAAAGTGCTTCAGCTAATTCTCGAGAATTAGCTGAAGCACTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1387s1c1
Sequence:CCGGGCTGGTTAAGAAGGAGAACATCTCGAGATGTTCTCCTTCTTAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-349s1c1
Sequence:CCGGCGGATAGATGAAGGAGACATTCTCGAGAATGTCTCCTTCATCTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1835s1c1
Sequence:CCGGGCTCCGTATAATCTCACCTTTCTCGAGAAAGGTGAGATTATACGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-534s1c1
Sequence:CCGGCTCAGCTCTCAAAGGTAAGAACTCGAGTTCTTACCTTTGAGAGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173597
MYO1H MISSION shRNA Lentiviral Transduction Particles
myosin IH
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-543s1c1
Sequence:CCGGCAAAGGTAAGAAGTGGGCAATCTCGAGATTGCCCACTTCTTACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-465s1c1
Sequence:CCGGGCAACTCATTCTTACTCAGAACTCGAGTTCTGAGTAAGAATGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-358s1c1
Sequence:CCGGGAAGGAGACATTAATCCGAAACTCGAGTTTCGGATTAATGTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-385s1c1
Sequence:CCGGCAGCTAATTAGCCATGAGAAACTCGAGTTTCTCATGGCTAATTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-373s1c1
Sequence:CCGGCCGAAAGTGCTTCAGCTAATTCTCGAGAATTAGCTGAAGCACTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1387s1c1
Sequence:CCGGGCTGGTTAAGAAGGAGAACATCTCGAGATGTTCTCCTTCTTAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-349s1c1
Sequence:CCGGCGGATAGATGAAGGAGACATTCTCGAGAATGTCTCCTTCATCTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173597.1-1835s1c1
Sequence:CCGGGCTCCGTATAATCTCACCTTTCTCGAGAAAGGTGAGATTATACGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173597.1-534s1c1
Sequence:CCGGCTCAGCTCTCAAAGGTAAGAACTCGAGTTCTTACCTTTGAGAGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146163
MYO1H MISSION shRNA Bacterial Glycerol Stock
myosin IH
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146163.2-1664s1c1
Sequence:CCGGCGTGAGTAGAAGCAGAGTTTACTCGAGTAAACTCTGCTTCTACTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-588s1c1
Sequence:CCGGCAAGTATGACAGGAAGGGCTTCTCGAGAAGCCCTTCCTGTCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-517s1c1
Sequence:CCGGGAAAGCAACATAAATCCCAAACTCGAGTTTGGGATTTATGTTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-478s1c1
Sequence:CCGGGAGAGCTTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-511s1c1
Sequence:CCGGCTGGATGAAAGCAACATAAATCTCGAGATTTATGTTGCTTTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146163
MYO1H MISSION shRNA shRNA Plasmid DNA
myosin IH
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146163.2-1664s1c1
Sequence:CCGGCGTGAGTAGAAGCAGAGTTTACTCGAGTAAACTCTGCTTCTACTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-588s1c1
Sequence:CCGGCAAGTATGACAGGAAGGGCTTCTCGAGAAGCCCTTCCTGTCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-517s1c1
Sequence:CCGGGAAAGCAACATAAATCCCAAACTCGAGTTTGGGATTTATGTTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-478s1c1
Sequence:CCGGGAGAGCTTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-511s1c1
Sequence:CCGGCTGGATGAAAGCAACATAAATCTCGAGATTTATGTTGCTTTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146163
MYO1H MISSION shRNA Lentiviral Transduction Particles
myosin IH
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146163.2-1664s1c1
Sequence:CCGGCGTGAGTAGAAGCAGAGTTTACTCGAGTAAACTCTGCTTCTACTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-588s1c1
Sequence:CCGGCAAGTATGACAGGAAGGGCTTCTCGAGAAGCCCTTCCTGTCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-517s1c1
Sequence:CCGGGAAAGCAACATAAATCCCAAACTCGAGTTTGGGATTTATGTTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-478s1c1
Sequence:CCGGGAGAGCTTGAACCAACTGTTTCTCGAGAAACAGTTGGTTCAAGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146163.2-511s1c1
Sequence:CCGGCTGGATGAAAGCAACATAAATCTCGAGATTTATGTTGCTTTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)