EMAIL THIS PAGE TO A FRIEND

MYO3A

myosin IIIA

136 Gene Product Result for
Synonyms: DFNB30
UniProtKB ID: Q8NEV4, Q5VZ28, Q8WX17, Q9NYS8
Gene ID:
Human(53904) Summary: The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
Mouse(667663) myosin IIIA
Rat(498806) myosin IIIA
Zebrafish(402814) myosin IIIA
cow(535824) myosin IIIA
Horse(100055461) myosin IIIA
dog(487106) myosin IIIA
chicken(420494) myosin IIIA
sheep(101114632) myosin IIIA
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120891 MISSION® esiRNA esiRNA human MYO3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017433 Rosetta Predictions human pricing
XM_001053631 Rosetta Predictions rat pricing
XM_574090 Rosetta Predictions rat pricing
NM_148413 Rosetta Predictions mouse pricing
XM_991742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083525 predicted 1897
2 SASI_Hs01_00083527 predicted 3302
3 SASI_Hs01_00083528 predicted 3337
4 SASI_Hs01_00083529 predicted 3492
5 SASI_Hs01_00083530 predicted 4138
6 SASI_Hs01_00083532 predicted 1017
7 SASI_Hs01_00083533 predicted 4743
8 SASI_Hs02_00350009 predicted 2953
9 SASI_Hs01_00083534 predicted 3441
10 SASI_Hs02_00350010 predicted 960
11 SASI_Hs01_00083526 predicted 2798
12 SASI_Hs01_00083531 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273015 predicted 1429
2 SASI_Rn02_00273016 predicted 611
3 SASI_Rn02_00273017 predicted 4568
4 SASI_Rn02_00273018 predicted 4519
5 SASI_Rn02_00273019 predicted 2288
6 SASI_Rn02_00273020 predicted 221
7 SASI_Rn02_00273021 predicted 2691
8 SASI_Rn02_00273022 predicted 3135
9 SASI_Rn02_00273023 predicted 3081
10 SASI_Rn02_00273024 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401359 predicted 2168
2 SASI_Rn02_00401360 predicted 1347
3 SASI_Rn02_00401361 predicted 460
4 SASI_Rn02_00401362 predicted 5316
5 SASI_Rn02_00401363 predicted 5267
6 SASI_Rn02_00401364 predicted 3030
7 SASI_Rn02_00401365 predicted 965
8 SASI_Rn02_00401366 predicted 3870
9 SASI_Rn02_00401367 predicted 471
10 SASI_Rn02_00401368 predicted 3819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163626 predicted 3590
2 SASI_Mm02_00342715 predicted 4517
3 SASI_Mm01_00163627 predicted 473
4 SASI_Mm02_00342716 predicted 609
5 SASI_Mm01_00163628 predicted 535
6 SASI_Mm02_00342717 predicted 4572
7 SASI_Mm01_00163629 predicted 2692
8 SASI_Mm01_00163630 predicted 3426
9 SASI_Mm01_00163631 predicted 4161
10 SASI_Mm01_00163633 predicted 3128
11 SASI_Mm01_00163625 predicted 1086
12 SASI_Mm01_00163632 predicted 3333
13 SASI_Mm01_00163634 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258188 predicted 1924
2 SASI_Mm01_00258189 predicted 236
3 SASI_Mm01_00258190 predicted 620
4 SASI_Mm01_00258191 predicted 768
5 SASI_Mm01_00258192 predicted 691
6 SASI_Mm01_00258193 predicted 2013
7 SASI_Mm01_00258194 predicted 2119
8 SASI_Mm01_00258195 predicted 757
9 SASI_Mm01_00258196 predicted 1274
10 SASI_Mm01_00258197 predicted 1575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017433
MYO3A MISSION shRNA Bacterial Glycerol Stock
myosin IIIA
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-536s1c1
Sequence:CCGGGAGCCTCTAATTGCCTATATTCTCGAGAATATAGGCAATTAGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017433.3-5302s1c1
Sequence:CCGGCCCTAATCTATCACTTTGTTCCTCGAGGAACAAAGTGATAGATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-320s1c1
Sequence:CCGGCTTGATCCAATTCACGATATTCTCGAGAATATCGTGAATTGGATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-3298s1c1
Sequence:CCGGCGTGGAGCAGTTAAATCTAATCTCGAGATTAGATTTAACTGCTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-2965s1c1
Sequence:CCGGCCTGATGGATTTGTTGTCTAACTCGAGTTAGACAACAAATCCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-377s1c1
Sequence:CCGGGCACTTTCTGACCACCCTAATCTCGAGATTAGGGTGGTCAGAAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017433.x-5454s1c1
Sequence:CCGGTAGCGGTTGAATCTTAGAGAACTCGAGTTCTCTAAGATTCAACCGCTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-1794s1c1
Sequence:CCGGCCCATTACAAACTGCCTGAAACTCGAGTTTCAGGCAGTTTGTAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-4214s1c1
Sequence:CCGGGCGGTATTCATTCAGAGCAAACTCGAGTTTGCTCTGAATGAATACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017433
MYO3A MISSION shRNA shRNA Plasmid DNA
myosin IIIA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-536s1c1
Sequence:CCGGGAGCCTCTAATTGCCTATATTCTCGAGAATATAGGCAATTAGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017433.3-5302s1c1
Sequence:CCGGCCCTAATCTATCACTTTGTTCCTCGAGGAACAAAGTGATAGATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-320s1c1
Sequence:CCGGCTTGATCCAATTCACGATATTCTCGAGAATATCGTGAATTGGATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-3298s1c1
Sequence:CCGGCGTGGAGCAGTTAAATCTAATCTCGAGATTAGATTTAACTGCTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-2965s1c1
Sequence:CCGGCCTGATGGATTTGTTGTCTAACTCGAGTTAGACAACAAATCCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-377s1c1
Sequence:CCGGGCACTTTCTGACCACCCTAATCTCGAGATTAGGGTGGTCAGAAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017433.x-5454s1c1
Sequence:CCGGTAGCGGTTGAATCTTAGAGAACTCGAGTTCTCTAAGATTCAACCGCTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-1794s1c1
Sequence:CCGGCCCATTACAAACTGCCTGAAACTCGAGTTTCAGGCAGTTTGTAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-4214s1c1
Sequence:CCGGGCGGTATTCATTCAGAGCAAACTCGAGTTTGCTCTGAATGAATACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017433
MYO3A MISSION shRNA Lentiviral Transduction Particles
myosin IIIA
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-536s1c1
Sequence:CCGGGAGCCTCTAATTGCCTATATTCTCGAGAATATAGGCAATTAGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017433.3-5302s1c1
Sequence:CCGGCCCTAATCTATCACTTTGTTCCTCGAGGAACAAAGTGATAGATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-320s1c1
Sequence:CCGGCTTGATCCAATTCACGATATTCTCGAGAATATCGTGAATTGGATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017433.3-3298s1c1
Sequence:CCGGCGTGGAGCAGTTAAATCTAATCTCGAGATTAGATTTAACTGCTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-2965s1c1
Sequence:CCGGCCTGATGGATTTGTTGTCTAACTCGAGTTAGACAACAAATCCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-377s1c1
Sequence:CCGGGCACTTTCTGACCACCCTAATCTCGAGATTAGGGTGGTCAGAAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017433.x-5454s1c1
Sequence:CCGGTAGCGGTTGAATCTTAGAGAACTCGAGTTCTCTAAGATTCAACCGCTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-1794s1c1
Sequence:CCGGCCCATTACAAACTGCCTGAAACTCGAGTTTCAGGCAGTTTGTAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017433.x-4214s1c1
Sequence:CCGGGCGGTATTCATTCAGAGCAAACTCGAGTTTGCTCTGAATGAATACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148413
MYO3A MISSION shRNA Bacterial Glycerol Stock
myosin IIIA
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-772s1c1
Sequence:CCGGGCAGAGTTCAATGACTTCATTCTCGAGAATGAAGTCATTGAACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-4255s1c1
Sequence:CCGGGCGTGGGATTTAGCAATGTTTCTCGAGAAACATTGCTAAATCCCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-2968s1c1
Sequence:CCGGCGGATACTCTTCGCTAACTTTCTCGAGAAAGTTAGCGAAGAGTATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-1806s1c1
Sequence:CCGGCGCCATCTTGAACGTTGGAAACTCGAGTTTCCAACGTTCAAGATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-3714s1c1
Sequence:CCGGCCAGAGTTACTGTCAGTGGTACTCGAGTACCACTGACAGTAACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1268s21c1
Sequence:CCGGCAGACCAGTGCATCGTTATTTCTCGAGAAATAACGATGCACTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-3591s21c1
Sequence:CCGGACAGAATCAAGAGCTATATATCTCGAGATATATAGCTCTTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2789s21c1
Sequence:GTACCGGGATACTCCTTGATGGATTTATCTCGAGATAAATCCATCAAGGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2969s21c1
Sequence:CCGGGGATACTCTTCGCTAACTTTACTCGAGTAAAGTTAGCGAAGAGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1420s21c1
Sequence:CCGGGGCAATGCCTGCACTATTATACTCGAGTATAATAGTGCAGGCATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148413
MYO3A MISSION shRNA shRNA Plasmid DNA
myosin IIIA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-772s1c1
Sequence:CCGGGCAGAGTTCAATGACTTCATTCTCGAGAATGAAGTCATTGAACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-4255s1c1
Sequence:CCGGGCGTGGGATTTAGCAATGTTTCTCGAGAAACATTGCTAAATCCCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-2968s1c1
Sequence:CCGGCGGATACTCTTCGCTAACTTTCTCGAGAAAGTTAGCGAAGAGTATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-1806s1c1
Sequence:CCGGCGCCATCTTGAACGTTGGAAACTCGAGTTTCCAACGTTCAAGATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-3714s1c1
Sequence:CCGGCCAGAGTTACTGTCAGTGGTACTCGAGTACCACTGACAGTAACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1268s21c1
Sequence:CCGGCAGACCAGTGCATCGTTATTTCTCGAGAAATAACGATGCACTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-3591s21c1
Sequence:CCGGACAGAATCAAGAGCTATATATCTCGAGATATATAGCTCTTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2789s21c1
Sequence:GTACCGGGATACTCCTTGATGGATTTATCTCGAGATAAATCCATCAAGGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2969s21c1
Sequence:CCGGGGATACTCTTCGCTAACTTTACTCGAGTAAAGTTAGCGAAGAGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1420s21c1
Sequence:CCGGGGCAATGCCTGCACTATTATACTCGAGTATAATAGTGCAGGCATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148413
MYO3A MISSION shRNA Lentiviral Transduction Particles
myosin IIIA
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-772s1c1
Sequence:CCGGGCAGAGTTCAATGACTTCATTCTCGAGAATGAAGTCATTGAACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-4255s1c1
Sequence:CCGGGCGTGGGATTTAGCAATGTTTCTCGAGAAACATTGCTAAATCCCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-2968s1c1
Sequence:CCGGCGGATACTCTTCGCTAACTTTCTCGAGAAAGTTAGCGAAGAGTATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-1806s1c1
Sequence:CCGGCGCCATCTTGAACGTTGGAAACTCGAGTTTCCAACGTTCAAGATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148413.1-3714s1c1
Sequence:CCGGCCAGAGTTACTGTCAGTGGTACTCGAGTACCACTGACAGTAACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1268s21c1
Sequence:CCGGCAGACCAGTGCATCGTTATTTCTCGAGAAATAACGATGCACTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-3591s21c1
Sequence:CCGGACAGAATCAAGAGCTATATATCTCGAGATATATAGCTCTTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2789s21c1
Sequence:GTACCGGGATACTCCTTGATGGATTTATCTCGAGATAAATCCATCAAGGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-2969s21c1
Sequence:CCGGGGATACTCTTCGCTAACTTTACTCGAGTAAAGTTAGCGAAGAGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148413.2-1420s21c1
Sequence:CCGGGGCAATGCCTGCACTATTATACTCGAGTATAATAGTGCAGGCATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)