EMAIL THIS PAGE TO A FRIEND

MYO3B

myosin IIIB

339 Gene Product Result for
Gene ID:
Mouse(329421) myosin IIIB
Rat(366069) myosin IIIB
Zebrafish(564573) myosin IIIB
Horse(100063200) myosin IIIB
dog(478792) myosin IIIB
chicken(424157) myosin IIIB
sheep(101118079) myosin IIIB
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083615 Rosetta Predictions human pricing
NM_138995 Rosetta Predictions human pricing
XM_001059499 Rosetta Predictions rat pricing
XM_345366 Rosetta Predictions rat pricing
NM_177376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317141 predicted 941
2 SASI_Hs02_00317142 predicted 1170
3 SASI_Hs02_00317143 predicted 1425
4 SASI_Hs02_00317144 predicted 371
5 SASI_Hs02_00317145 predicted 255
6 SASI_Hs02_00317146 predicted 1892
7 SASI_Hs02_00317147 predicted 932
8 SASI_Hs02_00317148 predicted 1989
9 SASI_Hs02_00317149 predicted 4113
10 SASI_Hs02_00317150 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236312 predicted 943
2 SASI_Hs01_00236313 predicted 1171
3 SASI_Hs01_00236314 predicted 1432
4 SASI_Hs01_00236315 predicted 369
5 SASI_Hs01_00236316 predicted 261
6 SASI_Hs01_00236317 predicted 1891
7 SASI_Hs02_00364040 predicted 926
8 SASI_Hs02_00364041 predicted 1986
9 SASI_Hs02_00364042 predicted 4200
10 SASI_Hs01_00236320 predicted 1907
11 SASI_Hs01_00236311 predicted 2774
12 SASI_Hs01_00236318 predicted 1895
13 SASI_Hs01_00236319 predicted 3444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293441 predicted 2577
2 SASI_Rn02_00293442 predicted 1074
3 SASI_Rn02_00293443 predicted 2748
4 SASI_Rn02_00293444 predicted 1710
5 SASI_Rn02_00293445 predicted 1933
6 SASI_Rn02_00293446 predicted 2735
7 SASI_Rn02_00293447 predicted 1348
8 SASI_Rn02_00293448 predicted 2529
9 SASI_Rn02_00293449 predicted 2814
10 SASI_Rn02_00293450 predicted 2761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398277 predicted 1164
2 SASI_Rn02_00398278 predicted 439
3 SASI_Rn02_00398279 predicted 840
4 SASI_Rn02_00398280 predicted 852
5 SASI_Rn02_00398281 predicted 821
6 SASI_Rn02_00398282 predicted 1212
7 SASI_Rn02_00398283 predicted 1174
8 SASI_Rn02_00398284 predicted 1203
9 SASI_Rn02_00398285 predicted 543
10 SASI_Rn02_00398286 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347542 predicted 852
2 SASI_Mm02_00347543 predicted 2680
3 SASI_Mm02_00347544 predicted 2854
4 SASI_Mm01_00159009 predicted 4070
5 SASI_Mm02_00347545 predicted 1317
6 SASI_Mm01_00159011 predicted 3631
7 SASI_Mm02_00347546 predicted 1417
8 SASI_Mm02_00347547 predicted 1861
9 SASI_Mm02_00347548 predicted 1186
10 SASI_Mm02_00347549 predicted 3597
11 SASI_Mm01_00159008 predicted 770
12 SASI_Mm01_00159010 predicted 757
13 SASI_Mm01_00159012 predicted 231
14 SASI_Mm01_00159013 predicted 964
15 SASI_Mm01_00159014 predicted 1266
16 SASI_Mm01_00159015 predicted 285
17 SASI_Mm01_00159016 predicted 573
18 SASI_Mm01_00159017 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138995
MYO3B MISSION shRNA Bacterial Glycerol Stock
myosin IIIB
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1200s1c1
Sequence:CCGGGTTCTGGATGAGGATACAATTCTCGAGAATTGTATCCTCATCCAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1995s1c1
Sequence:CCGGGCAGCTATTTCCTCTCAACATCTCGAGATGTTGAGAGGAAATAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-3671s1c1
Sequence:CCGGCCGTACACAGACTTCAAGCAACTCGAGTTGCTTGAAGTCTGTGTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-177s1c1
Sequence:CCGGCCTATGATGCTTGGACTTGAACTCGAGTTCAAGTCCAAGCATCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138995.x-4313s1c1
Sequence:CCGGCCATGCCTGAACCTTACTGAACTCGAGTTCAGTAAGGTTCAGGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-1297s1c1
Sequence:CCGGCCTTCCAGAATCTAAGCATATCTCGAGATATGCTTAGATTCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-3992s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138995
MYO3B MISSION shRNA shRNA Plasmid DNA
myosin IIIB
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1200s1c1
Sequence:CCGGGTTCTGGATGAGGATACAATTCTCGAGAATTGTATCCTCATCCAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1995s1c1
Sequence:CCGGGCAGCTATTTCCTCTCAACATCTCGAGATGTTGAGAGGAAATAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-3671s1c1
Sequence:CCGGCCGTACACAGACTTCAAGCAACTCGAGTTGCTTGAAGTCTGTGTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-177s1c1
Sequence:CCGGCCTATGATGCTTGGACTTGAACTCGAGTTCAAGTCCAAGCATCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138995.x-4313s1c1
Sequence:CCGGCCATGCCTGAACCTTACTGAACTCGAGTTCAGTAAGGTTCAGGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-1297s1c1
Sequence:CCGGCCTTCCAGAATCTAAGCATATCTCGAGATATGCTTAGATTCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-3992s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138995
MYO3B MISSION shRNA Lentiviral Transduction Particles
myosin IIIB
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1200s1c1
Sequence:CCGGGTTCTGGATGAGGATACAATTCTCGAGAATTGTATCCTCATCCAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-1995s1c1
Sequence:CCGGGCAGCTATTTCCTCTCAACATCTCGAGATGTTGAGAGGAAATAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-3671s1c1
Sequence:CCGGCCGTACACAGACTTCAAGCAACTCGAGTTGCTTGAAGTCTGTGTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138995.x-177s1c1
Sequence:CCGGCCTATGATGCTTGGACTTGAACTCGAGTTCAAGTCCAAGCATCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138995.x-4313s1c1
Sequence:CCGGCCATGCCTGAACCTTACTGAACTCGAGTTCAGTAAGGTTCAGGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-1297s1c1
Sequence:CCGGCCTTCCAGAATCTAAGCATATCTCGAGATATGCTTAGATTCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138995.1-3992s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177376
MYO3B MISSION shRNA Bacterial Glycerol Stock
myosin IIIB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177376.2-2083s1c1
Sequence:CCGGGCCGTCATACTCTATACAGTTCTCGAGAACTGTATAGAGTATGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-967s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-289s1c1
Sequence:CCGGGCTGTGTTGCTATCTTGGAAACTCGAGTTTCCAAGATAGCAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-520s1c1
Sequence:CCGGGCTATGATGCTCGGAGGAAATCTCGAGATTTCCTCCGAGCATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-72s1c1
Sequence:CCGGCCTCACTTTATTCGTTGCATTCTCGAGAATGCAACGAATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177376
MYO3B MISSION shRNA shRNA Plasmid DNA
myosin IIIB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177376.2-2083s1c1
Sequence:CCGGGCCGTCATACTCTATACAGTTCTCGAGAACTGTATAGAGTATGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-967s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-289s1c1
Sequence:CCGGGCTGTGTTGCTATCTTGGAAACTCGAGTTTCCAAGATAGCAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-520s1c1
Sequence:CCGGGCTATGATGCTCGGAGGAAATCTCGAGATTTCCTCCGAGCATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-72s1c1
Sequence:CCGGCCTCACTTTATTCGTTGCATTCTCGAGAATGCAACGAATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177376
MYO3B MISSION shRNA Lentiviral Transduction Particles
myosin IIIB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177376.2-2083s1c1
Sequence:CCGGGCCGTCATACTCTATACAGTTCTCGAGAACTGTATAGAGTATGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-967s1c1
Sequence:CCGGCCATGTACTATAACCAGTTAACTCGAGTTAACTGGTTATAGTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-289s1c1
Sequence:CCGGGCTGTGTTGCTATCTTGGAAACTCGAGTTTCCAAGATAGCAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-520s1c1
Sequence:CCGGGCTATGATGCTCGGAGGAAATCTCGAGATTTCCTCCGAGCATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177376.2-72s1c1
Sequence:CCGGCCTCACTTTATTCGTTGCATTCTCGAGAATGCAACGAATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)