EMAIL THIS PAGE TO A FRIEND

MYO5B

myosin VB

201 Gene Product Result for
UniProtKB ID: Q9ULV0, B0I1R3
Gene ID:
Human(4645) Summary: The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
Mouse(17919) myosin VB
Rat(25132) myosin Vb
Zebrafish(567402) myosin VB
cow(514078) myosin VB
Horse(100069390) myosin VB
dog(480220) myosin VB
chicken(430317) myosin VB
sheep(101112182) myosin VB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080467 Rosetta Predictions human pricing
XM_371116 Rosetta Predictions human pricing
XM_933747 Rosetta Predictions human pricing
XM_933749 Rosetta Predictions human pricing
XM_933751 Rosetta Predictions human pricing
NM_017083 Rosetta Predictions rat pricing
NM_201600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315116 predicted 3774
2 SASI_Hs02_00315117 predicted 5237
3 SASI_Hs02_00315118 predicted 5494
4 SASI_Hs02_00315119 predicted 1875
5 SASI_Hs02_00315120 predicted 1253
6 SASI_Hs02_00315121 predicted 5170
7 SASI_Hs02_00315122 predicted 2189
8 SASI_Hs02_00315123 predicted 776
9 SASI_Hs02_00315124 predicted 518
10 SASI_Hs02_00315125 predicted 2589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293089 predicted 1879
2 SASI_Hs01_00293090 predicted 1045
3 SASI_Hs01_00293091 predicted 1248
4 SASI_Hs01_00293092 predicted 1161
5 SASI_Hs01_00293093 predicted 1291
6 SASI_Hs01_00293094 predicted 775
7 SASI_Hs01_00293095 predicted 1856
8 SASI_Hs01_00293096 predicted 1858
9 SASI_Hs01_00293097 predicted 520
10 SASI_Hs01_00293098 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262406 predicted 534
2 SASI_Hs01_00262407 predicted 2008
3 SASI_Hs01_00262408 predicted 1179
4 SASI_Hs01_00262409 predicted 1382
5 SASI_Hs01_00262410 predicted 1293
6 SASI_Hs01_00262411 predicted 523
7 SASI_Hs01_00262412 predicted 1424
8 SASI_Hs01_00262413 predicted 899
9 SASI_Hs01_00262414 predicted 639
10 SASI_Hs01_00262415 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274086 predicted 1878
2 SASI_Hs01_00274087 predicted 1046
3 SASI_Hs01_00274088 predicted 1252
4 SASI_Hs01_00274089 predicted 1160
5 SASI_Hs01_00274090 predicted 1297
6 SASI_Hs01_00274091 predicted 781
7 SASI_Hs01_00274092 predicted 1851
8 SASI_Hs01_00274093 predicted 1860
9 SASI_Hs01_00274094 predicted 513
10 SASI_Hs01_00274095 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287975 predicted 986
2 SASI_Hs01_00287976 predicted 921
3 SASI_Hs01_00287977 predicted 553
4 SASI_Hs01_00287978 predicted 1237
5 SASI_Hs01_00287979 predicted 912
6 SASI_Hs01_00287980 predicted 545
7 SASI_Hs01_00287981 predicted 906
8 SASI_Hs01_00287982 predicted 553
9 SASI_Hs01_00287983 predicted 921
10 SASI_Hs01_00287984 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055639 predicted 4951
2 SASI_Rn01_00055640 predicted 353
3 SASI_Rn01_00055642 predicted 1124
4 SASI_Rn01_00055643 predicted 2079
5 SASI_Rn01_00055644 predicted 4152
6 SASI_Rn01_00055645 predicted 2128
7 SASI_Rn01_00055646 predicted 3760
8 SASI_Rn01_00055647 predicted 720
9 SASI_Rn02_00261296 predicted 3682
10 SASI_Rn01_00055648 predicted 4772
11 SASI_Rn01_00055641 predicted 5187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091544 predicted 5090
2 SASI_Mm01_00091545 predicted 353
3 SASI_Mm01_00091546 predicted 4867
4 SASI_Mm01_00091547 predicted 5147
5 SASI_Mm01_00091548 predicted 4601
6 SASI_Mm01_00091549 predicted 3673
7 SASI_Mm01_00091550 predicted 5253
8 SASI_Mm01_00091551 predicted 1434
9 SASI_Mm01_00091553 predicted 5660
10 SASI_Mm02_00351606 predicted 4852
11 SASI_Mm01_00091552 predicted 2123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201600
MYO5B MISSION shRNA Bacterial Glycerol Stock
myosin VB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-1633s21c1
Sequence:CCGGTACGATAACCAACCGTGTATACTCGAGTATACACGGTTGGTTATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4132s21c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201600.2-5857s21c1
Sequence:CCGGGCAGCTCCAGTCGCCATATAACTCGAGTTATATGGCGACTGGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4350s21c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-3997s21c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201600
MYO5B MISSION shRNA shRNA Plasmid DNA
myosin VB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-1633s21c1
Sequence:CCGGTACGATAACCAACCGTGTATACTCGAGTATACACGGTTGGTTATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4132s21c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201600.2-5857s21c1
Sequence:CCGGGCAGCTCCAGTCGCCATATAACTCGAGTTATATGGCGACTGGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4350s21c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-3997s21c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201600
MYO5B MISSION shRNA Lentiviral Transduction Particles
myosin VB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-1633s21c1
Sequence:CCGGTACGATAACCAACCGTGTATACTCGAGTATACACGGTTGGTTATCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4132s21c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201600.2-5857s21c1
Sequence:CCGGGCAGCTCCAGTCGCCATATAACTCGAGTTATATGGCGACTGGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-4350s21c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201600.2-3997s21c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080467
MYO5B MISSION shRNA Bacterial Glycerol Stock
myosin VB
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080467.1-6779s21c1
Sequence:CCGGTAATCAGTTCAGGGATATTATCTCGAGATAATATCCCTGAACTGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-1256s21c1
Sequence:CCGGTGGTGATTCCTGTAGTATATCCTCGAGGATATACTACAGGAATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-740s21c1
Sequence:CCGGCAAGTATGCCATGCGCTATTTCTCGAGAAATAGCGCATGGCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-5053s21c1
Sequence:CCGGGCGTGTTACAGCCGATGATAGCTCGAGCTATCATCGGCTGTAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-357s21c1
Sequence:CCGGACGATTCTGGAATACCCAATTCTCGAGAATTGGGTATTCCAGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080467
MYO5B MISSION shRNA shRNA Plasmid DNA
myosin VB
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080467.1-6779s21c1
Sequence:CCGGTAATCAGTTCAGGGATATTATCTCGAGATAATATCCCTGAACTGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-1256s21c1
Sequence:CCGGTGGTGATTCCTGTAGTATATCCTCGAGGATATACTACAGGAATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-740s21c1
Sequence:CCGGCAAGTATGCCATGCGCTATTTCTCGAGAAATAGCGCATGGCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-5053s21c1
Sequence:CCGGGCGTGTTACAGCCGATGATAGCTCGAGCTATCATCGGCTGTAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-357s21c1
Sequence:CCGGACGATTCTGGAATACCCAATTCTCGAGAATTGGGTATTCCAGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080467
MYO5B MISSION shRNA Lentiviral Transduction Particles
myosin VB
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080467.1-6779s21c1
Sequence:CCGGTAATCAGTTCAGGGATATTATCTCGAGATAATATCCCTGAACTGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-1256s21c1
Sequence:CCGGTGGTGATTCCTGTAGTATATCCTCGAGGATATACTACAGGAATCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-740s21c1
Sequence:CCGGCAAGTATGCCATGCGCTATTTCTCGAGAAATAGCGCATGGCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-5053s21c1
Sequence:CCGGGCGTGTTACAGCCGATGATAGCTCGAGCTATCATCGGCTGTAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080467.1-357s21c1
Sequence:CCGGACGATTCTGGAATACCCAATTCTCGAGAATTGGGTATTCCAGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358327
VALIDATED
MYO5B MISSION shRNA Bacterial Glycerol Stock
myosin VB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-923s1c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-571s1c1
Sequence:CCGGCGAACATCAATGCCAGAACAACTCGAGTTGTTCTGGCATTGATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358327.1-656s1c1
Sequence:CCGGCCAGACAAACAGGTTGCTGGACTCGAGTCCAGCAACCTGTTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-570s1c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-705s1c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358327
VALIDATED
MYO5B MISSION shRNA shRNA Plasmid DNA
myosin VB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-923s1c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-571s1c1
Sequence:CCGGCGAACATCAATGCCAGAACAACTCGAGTTGTTCTGGCATTGATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358327.1-656s1c1
Sequence:CCGGCCAGACAAACAGGTTGCTGGACTCGAGTCCAGCAACCTGTTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-570s1c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-705s1c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358327
VALIDATED
MYO5B MISSION shRNA Lentiviral Transduction Particles
myosin VB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-923s1c1
Sequence:CCGGGCTGAAGATTTACATGAAGAACTCGAGTTCTTCATGTAAATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-571s1c1
Sequence:CCGGCGAACATCAATGCCAGAACAACTCGAGTTGTTCTGGCATTGATGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358327.1-656s1c1
Sequence:CCGGCCAGACAAACAGGTTGCTGGACTCGAGTCCAGCAACCTGTTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-570s1c1
Sequence:CCGGCCGAACATCAATGCCAGAACACTCGAGTGTTCTGGCATTGATGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358327.1-705s1c1
Sequence:CCGGCATGAGGAGGAGGTGGAACATCTCGAGATGTTCCACCTCCTCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)