EMAIL THIS PAGE TO A FRIEND

MYO5C

myosin VC

104 Gene Product Result for
UniProtKB ID: Q9NQX4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0245 AQUA Peptide LGSAEEFNYT[R] cow, dog, human, mouse, rat pricing
AQ0244 AQUA Peptide VLASNPITEAVGNA[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063491 MISSION® esiRNA esiRNA targeting mouse Myo5c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018728 Rosetta Predictions human pricing
NM_001108167 Rosetta Predictions rat pricing
NM_001081322 Rosetta Predictions mouse pricing
XM_893139 Rosetta Predictions mouse pricing
XM_900611 Rosetta Predictions mouse pricing
XM_900621 Rosetta Predictions mouse pricing
XM_900627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184027 predicted 581
2 SASI_Hs01_00184028 predicted 520
3 SASI_Hs01_00184030 predicted 2774
4 SASI_Hs02_00352273 predicted 2297
5 SASI_Hs01_00184032 predicted 4660
6 SASI_Hs01_00184033 predicted 4148
7 SASI_Hs01_00184034 predicted 1845
8 SASI_Hs02_00352274 predicted 321
9 SASI_Hs01_00184035 predicted 5394
10 SASI_Hs02_00352275 predicted 234
11 SASI_Hs01_00184026 predicted 3611
12 SASI_Hs01_00184029 predicted 4508
13 SASI_Hs01_00184031 predicted 3039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236014 predicted 1053
2 SASI_Rn02_00236015 predicted 1540
3 SASI_Rn02_00236016 predicted 864
4 SASI_Rn02_00236017 predicted 924
5 SASI_Rn02_00236018 predicted 210
6 SASI_Rn02_00236019 predicted 1106
7 SASI_Rn02_00236020 predicted 1593
8 SASI_Rn02_00236021 predicted 1369
9 SASI_Rn02_00236022 predicted 318
10 SASI_Rn02_00236023 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297281 predicted 2378
2 SASI_Mm02_00297282 predicted 3637
3 SASI_Mm02_00297283 predicted 1729
4 SASI_Mm02_00297284 predicted 3618
5 SASI_Mm02_00297285 predicted 5129
6 SASI_Mm02_00297286 predicted 5435
7 SASI_Mm02_00297287 predicted 1516
8 SASI_Mm02_00297288 predicted 274
9 SASI_Mm02_00297289 predicted 2103
10 SASI_Mm02_00297290 predicted 3191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266634 predicted 4716
2 SASI_Mm01_00266635 predicted 4407
3 SASI_Mm01_00266636 predicted 4622
4 SASI_Mm01_00266637 predicted 4658
5 SASI_Mm01_00266638 predicted 4515
6 SASI_Mm01_00266639 predicted 4468
7 SASI_Mm01_00266640 predicted 4665
8 SASI_Mm01_00266641 predicted 4515
9 SASI_Mm01_00266642 predicted 4389
10 SASI_Mm01_00266643 predicted 4407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265232 predicted 2396
2 SASI_Mm01_00265233 predicted 3481
3 SASI_Mm01_00265234 predicted 3801
4 SASI_Mm01_00265235 predicted 3652
5 SASI_Mm01_00265236 predicted 1749
6 SASI_Mm01_00265237 predicted 3638
7 SASI_Mm01_00265238 predicted 3978
8 SASI_Mm01_00265239 predicted 1626
9 SASI_Mm01_00265240 predicted 2217
10 SASI_Mm01_00265241 predicted 2123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273379 predicted 364
2 SASI_Mm01_00273380 predicted 364
3 SASI_Mm01_00273381 predicted 392
4 SASI_Mm01_00273382 predicted 438
5 SASI_Mm01_00273383 predicted 308
6 SASI_Mm01_00273384 predicted 369
7 SASI_Mm01_00273385 predicted 368
8 SASI_Mm01_00273386 predicted 363
9 SASI_Mm01_00273387 predicted 306
10 SASI_Mm01_00273388 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262178 predicted 1174
2 SASI_Mm01_00262179 predicted 871
3 SASI_Mm01_00262180 predicted 1078
4 SASI_Mm01_00262181 predicted 1104
5 SASI_Mm01_00262182 predicted 973
6 SASI_Mm01_00262183 predicted 921
7 SASI_Mm01_00262184 predicted 1122
8 SASI_Mm01_00262185 predicted 976
9 SASI_Mm01_00262186 predicted 845
10 SASI_Mm01_00262187 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018728
VALIDATED
MYO5C MISSION shRNA Bacterial Glycerol Stock
myosin VC
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018728.1-356s1c1
Sequence:CCGGCAGTTGCCAATATACGGAGATCTCGAGATCTCCGTATATTGGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2612s21c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-3357s1c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-6378s21c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-4969s21c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2243s1c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2361s21c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-3475s21c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018728.1-6256s1c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-4851s1c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2494s1c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018728
VALIDATED
MYO5C MISSION shRNA shRNA Plasmid DNA
myosin VC
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018728.1-356s1c1
Sequence:CCGGCAGTTGCCAATATACGGAGATCTCGAGATCTCCGTATATTGGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2612s21c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-3357s1c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-6378s21c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-4969s21c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2243s1c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2361s21c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-3475s21c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018728.1-6256s1c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-4851s1c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2494s1c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018728
VALIDATED
MYO5C MISSION shRNA Lentiviral Transduction Particles
myosin VC
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018728.1-356s1c1
Sequence:CCGGCAGTTGCCAATATACGGAGATCTCGAGATCTCCGTATATTGGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2612s21c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-3357s1c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-6378s21c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-4969s21c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2243s1c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-2361s21c1
Sequence:CCGGGCAGGACAAGTGGCTTATTTACTCGAGTAAATAAGCCACTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018728.2-3475s21c1
Sequence:CCGGGCTATGACATTGAAGATGTAACTCGAGTTACATCTTCAATGTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018728.1-6256s1c1
Sequence:CCGGGCCAACATATTCACCATAATTCTCGAGAATTATGGTGAATATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-4851s1c1
Sequence:CCGGGCTACTTAGAAGAATGGCTTACTCGAGTAAGCCATTCTTCTAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018728.1-2494s1c1
Sequence:CCGGCCTGTATCAGTTGATTCGCATCTCGAGATGCGAATCAACTGATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081322
MYO5C MISSION shRNA Bacterial Glycerol Stock
myosin VC
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-825s21c1
Sequence:CCGGCCAGATCATTGGCGCCAATATCTCGAGATATTGGCGCCAATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-1520s21c1
Sequence:CCGGAGTTTAACCTGCACGTCTTTACTCGAGTAAAGACGTGCAGGTTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4606s21c1
Sequence:CCGGGATGTGGCCATACGGATTTATCTCGAGATAAATCCGTATGGCCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4652s21c1
Sequence:CCGGACAACCTCCAGCCGATAATAGCTCGAGCTATTATCGGCTGGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081322.1-5801s21c1
Sequence:CCGGTCGTTAGCTCCTCCTACTAAACTCGAGTTTAGTAGGAGGAGCTAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081322
MYO5C MISSION shRNA shRNA Plasmid DNA
myosin VC
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-825s21c1
Sequence:CCGGCCAGATCATTGGCGCCAATATCTCGAGATATTGGCGCCAATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-1520s21c1
Sequence:CCGGAGTTTAACCTGCACGTCTTTACTCGAGTAAAGACGTGCAGGTTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4606s21c1
Sequence:CCGGGATGTGGCCATACGGATTTATCTCGAGATAAATCCGTATGGCCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4652s21c1
Sequence:CCGGACAACCTCCAGCCGATAATAGCTCGAGCTATTATCGGCTGGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081322.1-5801s21c1
Sequence:CCGGTCGTTAGCTCCTCCTACTAAACTCGAGTTTAGTAGGAGGAGCTAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081322
MYO5C MISSION shRNA Lentiviral Transduction Particles
myosin VC
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-825s21c1
Sequence:CCGGCCAGATCATTGGCGCCAATATCTCGAGATATTGGCGCCAATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-1520s21c1
Sequence:CCGGAGTTTAACCTGCACGTCTTTACTCGAGTAAAGACGTGCAGGTTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4606s21c1
Sequence:CCGGGATGTGGCCATACGGATTTATCTCGAGATAAATCCGTATGGCCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081322.1-4652s21c1
Sequence:CCGGACAACCTCCAGCCGATAATAGCTCGAGCTATTATCGGCTGGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081322.1-5801s21c1
Sequence:CCGGTCGTTAGCTCCTCCTACTAAACTCGAGTTTAGTAGGAGGAGCTAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)