EMAIL THIS PAGE TO A FRIEND

MYO7A

myosin VIIA

121 Gene Product Result for
Synonyms: DFNA11 DFNB2 MYOVIIA MYU7A NSRD2 USH1B
Gene ID:
Human(4647) Summary: This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(17921) myosin VIIA
Rat(266714) myosin VIIA
chicken(419085) myosin VIIA
cow(535092) myosin VIIA
Horse(100063344) myosin VIIA
dog(485174) myosin VIIA
sheep(101113697) myosin VIIA
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078891 MISSION® esiRNA esiRNA targeting mouse Myo7a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000260 Rosetta Predictions human pricing
NM_001127179 Rosetta Predictions human pricing
NM_001127180 Rosetta Predictions human pricing
NM_153473 Rosetta Predictions rat pricing
NM_008663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120192 predicted 1358
2 SASI_Hs02_00302202 predicted 3474
3 SASI_Hs01_00120193 predicted 2539
4 SASI_Hs02_00302203 predicted 682
5 SASI_Hs01_00120194 predicted 1258
6 SASI_Hs01_00120196 predicted 1050
7 SASI_Hs01_00120197 predicted 3435
8 SASI_Hs01_00120198 predicted 891
9 SASI_Hs02_00302204 predicted 3272
10 SASI_Hs02_00302205 predicted 3256
11 SASI_Hs01_00120195 predicted 4472
12 SASI_Hs01_00120199 predicted 1719
13 SASI_Hs01_00120200 predicted 6175
14 SASI_Hs01_00120201 predicted 4642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328577 predicted 1359
2 SASI_Hs02_00328578 predicted 3466
3 SASI_Hs02_00328579 predicted 2532
4 SASI_Hs02_00328580 predicted 672
5 SASI_Hs02_00328581 predicted 1253
6 SASI_Hs02_00328582 predicted 1047
7 SASI_Hs02_00328583 predicted 3430
8 SASI_Hs02_00328584 predicted 884
9 SASI_Hs02_00328585 predicted 3265
10 SASI_Hs02_00328586 predicted 3254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328587 predicted 1353
2 SASI_Hs02_00328588 predicted 3469
3 SASI_Hs02_00328589 predicted 2535
4 SASI_Hs02_00328590 predicted 669
5 SASI_Hs02_00328591 predicted 1259
6 SASI_Hs02_00328592 predicted 1046
7 SASI_Hs02_00328593 predicted 3427
8 SASI_Hs02_00328594 predicted 882
9 SASI_Hs02_00328595 predicted 3262
10 SASI_Hs02_00328596 predicted 3250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042699 predicted 6004
2 SASI_Rn02_00268987 predicted 3774
3 SASI_Rn01_00042700 predicted 4510
4 SASI_Rn01_00042701 predicted 4458
5 SASI_Rn01_00042702 predicted 4129
6 SASI_Rn01_00042703 predicted 4030
7 SASI_Rn02_00268988 predicted 4969
8 SASI_Rn01_00042704 predicted 1712
9 SASI_Rn01_00042705 predicted 1090
10 SASI_Rn01_00042706 predicted 1698
11 SASI_Rn01_00042707 predicted 1470
12 SASI_Rn01_00042708 predicted 3266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148404 predicted 1255
2 SASI_Mm01_00148405 predicted 5991
3 SASI_Mm02_00314413 predicted 3654
4 SASI_Mm02_00314414 predicted 2223
5 SASI_Mm01_00148408 predicted 4113
6 SASI_Mm01_00148411 predicted 4617
7 SASI_Mm01_00148413 predicted 4086
8 SASI_Mm02_00314415 predicted 6343
9 SASI_Mm02_00314416 predicted 499
10 SASI_Mm02_00314417 predicted 2163
11 SASI_Mm01_00148406 predicted 5882
12 SASI_Mm01_00148407 predicted 3826
13 SASI_Mm01_00148409 predicted 4829
14 SASI_Mm01_00148410 predicted 2277
15 SASI_Mm01_00148412 predicted 6366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008663
VALIDATED
MYO7A MISSION shRNA Bacterial Glycerol Stock
myosin VIIA
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008663.1-6818s1c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-3822s1c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008663.1-2033s1c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-1897s1c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-4322s1c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008663.2-6954s21c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2283s21c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4072s21c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4572s21c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2147s21c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008663
VALIDATED
MYO7A MISSION shRNA shRNA Plasmid DNA
myosin VIIA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008663.1-6818s1c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-3822s1c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008663.1-2033s1c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-1897s1c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-4322s1c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008663.2-6954s21c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2283s21c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4072s21c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4572s21c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2147s21c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008663
VALIDATED
MYO7A MISSION shRNA Lentiviral Transduction Particles
myosin VIIA
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008663.1-6818s1c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-3822s1c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008663.1-2033s1c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-1897s1c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008663.1-4322s1c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008663.2-6954s21c1
Sequence:CCGGCCTGGTGTAAGAGTCTGTGTTCTCGAGAACACAGACTCTTACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2283s21c1
Sequence:CCGGCGCTACAGCTTTGTGGAGTTTCTCGAGAAACTCCACAAAGCTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4072s21c1
Sequence:CCGGCCCTGCTAACAGATTCAGCAACTCGAGTTGCTGAATCTGTTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-4572s21c1
Sequence:CCGGGCCCACAAGAAGGGAATTTATCTCGAGATAAATTCCCTTCTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008663.2-2147s21c1
Sequence:CCGGGCCCTTCTTTGTGCGTTGTATCTCGAGATACAACGCACAAAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000260
MYO7A MISSION shRNA Bacterial Glycerol Stock
myosin VIIA
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000260.1-7256s1c1
Sequence:CCGGCCACTGGGATAGAGGAATCAACTCGAGTTGATTCCTCTATCCCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-3476s1c1
Sequence:CCGGCCCTGTGATGACCAAGATTTACTCGAGTAAATCTTGGTCATCACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-6297s1c1
Sequence:CCGGGCCGATTCCATCTTCCACTATCTCGAGATAGTGGAAGATGGAATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-1757s1c1
Sequence:CCGGCCTGGACATGATTGCCAACAACTCGAGTTGTTGGCAATCATGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-2295s1c1
Sequence:CCGGCGCTACAGCTTCGTAGAGTTTCTCGAGAAACTCTACGAAGCTGTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000260.3-3252s21c1
Sequence:CCGGGAGGACCTCTCTGAGTATAAACTCGAGTTTATACTCAGAGAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000260
MYO7A MISSION shRNA shRNA Plasmid DNA
myosin VIIA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000260.1-7256s1c1
Sequence:CCGGCCACTGGGATAGAGGAATCAACTCGAGTTGATTCCTCTATCCCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-3476s1c1
Sequence:CCGGCCCTGTGATGACCAAGATTTACTCGAGTAAATCTTGGTCATCACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-6297s1c1
Sequence:CCGGGCCGATTCCATCTTCCACTATCTCGAGATAGTGGAAGATGGAATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-1757s1c1
Sequence:CCGGCCTGGACATGATTGCCAACAACTCGAGTTGTTGGCAATCATGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-2295s1c1
Sequence:CCGGCGCTACAGCTTCGTAGAGTTTCTCGAGAAACTCTACGAAGCTGTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000260.3-3252s21c1
Sequence:CCGGGAGGACCTCTCTGAGTATAAACTCGAGTTTATACTCAGAGAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000260
MYO7A MISSION shRNA Lentiviral Transduction Particles
myosin VIIA
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000260.1-7256s1c1
Sequence:CCGGCCACTGGGATAGAGGAATCAACTCGAGTTGATTCCTCTATCCCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-3476s1c1
Sequence:CCGGCCCTGTGATGACCAAGATTTACTCGAGTAAATCTTGGTCATCACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-6297s1c1
Sequence:CCGGGCCGATTCCATCTTCCACTATCTCGAGATAGTGGAAGATGGAATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-1757s1c1
Sequence:CCGGCCTGGACATGATTGCCAACAACTCGAGTTGTTGGCAATCATGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000260.1-2295s1c1
Sequence:CCGGCGCTACAGCTTCGTAGAGTTTCTCGAGAAACTCTACGAAGCTGTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000260.3-3252s21c1
Sequence:CCGGGAGGACCTCTCTGAGTATAAACTCGAGTTTATACTCAGAGAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)