EMAIL THIS PAGE TO A FRIEND

MYO7B

myosin VIIB

72 Gene Product Result for
UniProtKB ID: Q6PIF6, Q14786, Q8TEE1
Gene ID:
Mouse(17922) myosin VIIB
Rat(498834) myosin VIIb
chicken(424751) myosin VIIB
dog(483867) myosin VIIB
Horse(100069275) myosin VIIB
cow(522053) myosin VIIB
sheep(101118339) myosin VIIB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080527 Rosetta Predictions human pricing
XM_291001 Rosetta Predictions human pricing
XM_929403 Rosetta Predictions human pricing
XM_001059493 Rosetta Predictions rat pricing
XM_574117 Rosetta Predictions rat pricing
NM_032394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315707 predicted 5799
2 SASI_Hs02_00315708 predicted 1930
3 SASI_Hs02_00315709 predicted 1690
4 SASI_Hs02_00315710 predicted 2743
5 SASI_Hs02_00315711 predicted 1772
6 SASI_Hs02_00315712 predicted 3105
7 SASI_Hs02_00315713 predicted 1250
8 SASI_Hs02_00315714 predicted 1693
9 SASI_Hs02_00315715 predicted 2072
10 SASI_Hs02_00315716 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479029 predicted 2770
2 SASI_Hs02_00479030 predicted 2897
3 SASI_Hs02_00479031 predicted 1296
4 SASI_Hs02_00479032 predicted 2587
5 SASI_Hs02_00479033 predicted 862
6 SASI_Hs02_00479034 predicted 2955
7 SASI_Hs02_00479035 predicted 1447
8 SASI_Hs02_00479036 predicted 2693
9 SASI_Hs02_00479037 predicted 1159
10 SASI_Hs02_00479038 predicted 2917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249747 predicted 5755
2 SASI_Hs01_00249748 predicted 4733
3 SASI_Hs01_00249749 predicted 5564
4 SASI_Hs01_00249750 predicted 5657
5 SASI_Hs01_00249751 predicted 5167
6 SASI_Hs01_00249752 predicted 4833
7 SASI_Hs01_00249753 predicted 5155
8 SASI_Hs01_00249754 predicted 6134
9 SASI_Hs01_00249755 predicted 4996
10 SASI_Hs01_00249756 predicted 6140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293409 predicted 2059
2 SASI_Rn02_00293410 predicted 1107
3 SASI_Rn02_00293411 predicted 6203
4 SASI_Rn02_00293412 predicted 5033
5 SASI_Rn02_00293413 predicted 5936
6 SASI_Rn02_00293414 predicted 5825
7 SASI_Rn02_00293415 predicted 5539
8 SASI_Rn02_00293416 predicted 5107
9 SASI_Rn02_00293417 predicted 1813
10 SASI_Rn02_00293418 predicted 5073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401420 predicted 2063
2 SASI_Rn02_00401421 predicted 1102
3 SASI_Rn02_00401422 predicted 6202
4 SASI_Rn02_00401423 predicted 5034
5 SASI_Rn02_00401424 predicted 5942
6 SASI_Rn02_00401425 predicted 5826
7 SASI_Rn02_00401426 predicted 5537
8 SASI_Rn02_00401427 predicted 5107
9 SASI_Rn02_00401428 predicted 1813
10 SASI_Rn02_00401429 predicted 5070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337237 predicted 3946
2 SASI_Mm02_00337238 predicted 1112
3 SASI_Mm01_00155984 predicted 6191
4 SASI_Mm02_00337239 predicted 1211
5 SASI_Mm01_00155985 predicted 3144
6 SASI_Mm01_00155987 predicted 1631
7 SASI_Mm01_00155988 predicted 5851
8 SASI_Mm01_00155989 predicted 5063
9 SASI_Mm01_00155990 predicted 1851
10 SASI_Mm01_00155992 predicted 575
11 SASI_Mm01_00155983 predicted 1033
12 SASI_Mm01_00155986 predicted 1241
13 SASI_Mm01_00155991 predicted 6083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080527
MYO7B MISSION shRNA Bacterial Glycerol Stock
myosin VIIB
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5713s21c1
Sequence:CCGGAGGTGTACTTCATGCGGAAATCTCGAGATTTCCGCATGAAGTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-1510s21c1
Sequence:CCGGATATCCACTACACCGACAATCCTCGAGGATTGTCGGTGTAGTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5047s21c1
Sequence:CCGGACATCGCCTGCCAGATCTTTGCTCGAGCAAAGATCTGGCAGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-319s21c1
Sequence:CCGGACCAGCAGCACAAGATCTATACTCGAGTATAGATCTTGTGCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-3952s21c1
Sequence:CCGGCTGTCAGCACCGAGCTTATTTCTCGAGAAATAAGCTCGGTGCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080527
MYO7B MISSION shRNA shRNA Plasmid DNA
myosin VIIB
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5713s21c1
Sequence:CCGGAGGTGTACTTCATGCGGAAATCTCGAGATTTCCGCATGAAGTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-1510s21c1
Sequence:CCGGATATCCACTACACCGACAATCCTCGAGGATTGTCGGTGTAGTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5047s21c1
Sequence:CCGGACATCGCCTGCCAGATCTTTGCTCGAGCAAAGATCTGGCAGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-319s21c1
Sequence:CCGGACCAGCAGCACAAGATCTATACTCGAGTATAGATCTTGTGCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-3952s21c1
Sequence:CCGGCTGTCAGCACCGAGCTTATTTCTCGAGAAATAAGCTCGGTGCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080527
MYO7B MISSION shRNA Lentiviral Transduction Particles
myosin VIIB
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5713s21c1
Sequence:CCGGAGGTGTACTTCATGCGGAAATCTCGAGATTTCCGCATGAAGTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-1510s21c1
Sequence:CCGGATATCCACTACACCGACAATCCTCGAGGATTGTCGGTGTAGTGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-5047s21c1
Sequence:CCGGACATCGCCTGCCAGATCTTTGCTCGAGCAAAGATCTGGCAGGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-319s21c1
Sequence:CCGGACCAGCAGCACAAGATCTATACTCGAGTATAGATCTTGTGCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080527.1-3952s21c1
Sequence:CCGGCTGTCAGCACCGAGCTTATTTCTCGAGAAATAAGCTCGGTGCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032394
MYO7B MISSION shRNA Bacterial Glycerol Stock
myosin VIIB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5954s1c1
Sequence:CCGGGCAACTGGCTAGTGTCTCAAACTCGAGTTTGAGACACTAGCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-2198s1c1
Sequence:CCGGCCGCTACACATTTGATGAGTTCTCGAGAACTCATCAAATGTGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1712s1c1
Sequence:CCGGCCATGCCAACAACAAGTCCTTCTCGAGAAGGACTTGTTGTTGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5484s1c1
Sequence:CCGGGCTGAGCAGAATGTCTCCAAACTCGAGTTTGGAGACATTCTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1139s1c1
Sequence:CCGGCCTGGATTCGTCTGATGTGATCTCGAGATCACATCAGACGAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032394
MYO7B MISSION shRNA shRNA Plasmid DNA
myosin VIIB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5954s1c1
Sequence:CCGGGCAACTGGCTAGTGTCTCAAACTCGAGTTTGAGACACTAGCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-2198s1c1
Sequence:CCGGCCGCTACACATTTGATGAGTTCTCGAGAACTCATCAAATGTGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1712s1c1
Sequence:CCGGCCATGCCAACAACAAGTCCTTCTCGAGAAGGACTTGTTGTTGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5484s1c1
Sequence:CCGGGCTGAGCAGAATGTCTCCAAACTCGAGTTTGGAGACATTCTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1139s1c1
Sequence:CCGGCCTGGATTCGTCTGATGTGATCTCGAGATCACATCAGACGAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032394
MYO7B MISSION shRNA Lentiviral Transduction Particles
myosin VIIB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5954s1c1
Sequence:CCGGGCAACTGGCTAGTGTCTCAAACTCGAGTTTGAGACACTAGCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-2198s1c1
Sequence:CCGGCCGCTACACATTTGATGAGTTCTCGAGAACTCATCAAATGTGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1712s1c1
Sequence:CCGGCCATGCCAACAACAAGTCCTTCTCGAGAAGGACTTGTTGTTGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-5484s1c1
Sequence:CCGGGCTGAGCAGAATGTCTCCAAACTCGAGTTTGGAGACATTCTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032394.1-1139s1c1
Sequence:CCGGCCTGGATTCGTCTGATGTGATCTCGAGATCACATCAGACGAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)