EMAIL THIS PAGE TO A FRIEND

MYO9A

myosin IXA

171 Gene Product Result for
Gene ID:
Human(4649) Summary: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
Mouse(270163) myosin IXa
Rat(171296) myosin IXA
chicken(415323) myosin IXA
cow(521389) myosin IXA
Horse(100052350) myosin IXA
dog(487630) myosin IXA
chicken(101667954) myosin IXA
chicken(101748321) myosin IXA
sheep(101108657) myosin IXA
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006901 Rosetta Predictions human pricing
NM_134335 Rosetta Predictions rat pricing
XM_886170 Rosetta Predictions mouse pricing
XM_917816 Rosetta Predictions mouse pricing
XM_981204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115209 predicted 809
2 SASI_Hs01_00115211 predicted 7068
3 SASI_Hs02_00342577 predicted 7886
4 SASI_Hs02_00342578 predicted 6764
5 SASI_Hs02_00342579 predicted 1445
6 SASI_Hs02_00342580 predicted 1132
7 SASI_Hs01_00115214 predicted 1650
8 SASI_Hs01_00115215 predicted 6651
9 SASI_Hs02_00342581 predicted 6881
10 SASI_Hs01_00115216 predicted 4494
11 SASI_Hs01_00115208 predicted 6775
12 SASI_Hs01_00115210 predicted 1521
13 SASI_Hs01_00115212 predicted 3268
14 SASI_Hs01_00115213 predicted 5199
15 SASI_Hs01_00115217 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086838 predicted 1721
2 SASI_Rn01_00086839 predicted 8252
3 SASI_Rn02_00267890 predicted 3848
4 SASI_Rn01_00086841 predicted 1938
5 SASI_Rn01_00086842 predicted 5184
6 SASI_Rn01_00086843 predicted 1684
7 SASI_Rn01_00086844 predicted 2834
8 SASI_Rn01_00086845 predicted 4044
9 SASI_Rn01_00086846 predicted 7466
10 SASI_Rn02_00267891 predicted 7876
11 SASI_Rn01_00086840 predicted 7437
12 SASI_Rn01_00086847 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204406 predicted 1480
2 SASI_Mm01_00204407 predicted 619
3 SASI_Mm01_00204408 predicted 408
4 SASI_Mm01_00204409 predicted 1487
5 SASI_Mm01_00204410 predicted 371
6 SASI_Mm01_00204411 predicted 500
7 SASI_Mm01_00204412 predicted 432
8 SASI_Mm01_00204413 predicted 318
9 SASI_Mm01_00204414 predicted 594
10 SASI_Mm01_00204415 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441435 predicted 1742
2 SASI_Mm02_00441436 predicted 8081
3 SASI_Mm02_00441437 predicted 2421
4 SASI_Mm02_00441438 predicted 1501
5 SASI_Mm02_00441439 predicted 1748
6 SASI_Mm02_00441440 predicted 7286
7 SASI_Mm02_00441441 predicted 589
8 SASI_Mm02_00441442 predicted 6860
9 SASI_Mm02_00441443 predicted 3862
10 SASI_Mm02_00441444 predicted 7136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236240 predicted 1743
2 SASI_Mm01_00236241 predicted 8081
3 SASI_Mm01_00236242 predicted 2422
4 SASI_Mm01_00236243 predicted 1498
5 SASI_Mm01_00236245 predicted 1750
6 SASI_Mm01_00236246 predicted 7293
7 SASI_Mm01_00236247 predicted 589
8 SASI_Mm02_00447532 predicted 6857
9 SASI_Mm01_00236248 predicted 3860
10 SASI_Mm02_00447533 predicted 7135
11 SASI_Mm01_00236244 predicted 2309
12 SASI_Mm01_00236249 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006901
VALIDATED
MYO9A MISSION shRNA Bacterial Glycerol Stock
myosin IXA
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-6253s1c1
Sequence:CCGGCCACCCAATATAGCATCCCTACTCGAGTAGGGATGCTATATTGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3389s1c1
Sequence:CCGGCCAGAGATTCTGGAGGAATTACTCGAGTAATTCCTCCAGAATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006901.1-8090s1c1
Sequence:CCGGGCCTTGGCTGTTGTATTTGAACTCGAGTTCAAATACAACAGCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-8017s1c1
Sequence:CCGGGCTAAGACTGTATGTGCTGAACTCGAGTTCAGCACATACAGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-2916s1c1
Sequence:CCGGGCCCAGTTTCAGGCATCATTACTCGAGTAATGATGCCTGAAACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-5203s1c1
Sequence:CCGGGCCACAATTCTGATGACCTTTCTCGAGAAAGGTCATCAGAATTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-6765s21c1
Sequence:CCGGCGAAAGTCTGGTTCGACTAATCTCGAGATTAGTCGAACCAGACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-1435s21c1
Sequence:CCGGAGAAGTCCAGACTCGTTTATCCTCGAGGATAAACGAGTCTGGACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-4847s1c1
Sequence:CCGGGCCAAGAATTGGAGAGTGTTTCTCGAGAAACACTCTCCAATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3543s1c1
Sequence:CCGGGCCATCGTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAACGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-4308s21c1
Sequence:CCGGGAACTAGAGCAAGCTATATTTCTCGAGAAATATAGCTTGCTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006901
VALIDATED
MYO9A MISSION shRNA shRNA Plasmid DNA
myosin IXA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-6253s1c1
Sequence:CCGGCCACCCAATATAGCATCCCTACTCGAGTAGGGATGCTATATTGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3389s1c1
Sequence:CCGGCCAGAGATTCTGGAGGAATTACTCGAGTAATTCCTCCAGAATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006901.1-8090s1c1
Sequence:CCGGGCCTTGGCTGTTGTATTTGAACTCGAGTTCAAATACAACAGCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-8017s1c1
Sequence:CCGGGCTAAGACTGTATGTGCTGAACTCGAGTTCAGCACATACAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-2916s1c1
Sequence:CCGGGCCCAGTTTCAGGCATCATTACTCGAGTAATGATGCCTGAAACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-5203s1c1
Sequence:CCGGGCCACAATTCTGATGACCTTTCTCGAGAAAGGTCATCAGAATTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-6765s21c1
Sequence:CCGGCGAAAGTCTGGTTCGACTAATCTCGAGATTAGTCGAACCAGACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-1435s21c1
Sequence:CCGGAGAAGTCCAGACTCGTTTATCCTCGAGGATAAACGAGTCTGGACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-4847s1c1
Sequence:CCGGGCCAAGAATTGGAGAGTGTTTCTCGAGAAACACTCTCCAATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3543s1c1
Sequence:CCGGGCCATCGTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAACGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-4308s21c1
Sequence:CCGGGAACTAGAGCAAGCTATATTTCTCGAGAAATATAGCTTGCTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006901
VALIDATED
MYO9A MISSION shRNA Lentiviral Transduction Particles
myosin IXA
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-6253s1c1
Sequence:CCGGCCACCCAATATAGCATCCCTACTCGAGTAGGGATGCTATATTGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3389s1c1
Sequence:CCGGCCAGAGATTCTGGAGGAATTACTCGAGTAATTCCTCCAGAATCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006901.1-8090s1c1
Sequence:CCGGGCCTTGGCTGTTGTATTTGAACTCGAGTTCAAATACAACAGCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-8017s1c1
Sequence:CCGGGCTAAGACTGTATGTGCTGAACTCGAGTTCAGCACATACAGTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-2916s1c1
Sequence:CCGGGCCCAGTTTCAGGCATCATTACTCGAGTAATGATGCCTGAAACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006901.1-5203s1c1
Sequence:CCGGGCCACAATTCTGATGACCTTTCTCGAGAAAGGTCATCAGAATTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-6765s21c1
Sequence:CCGGCGAAAGTCTGGTTCGACTAATCTCGAGATTAGTCGAACCAGACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-1435s21c1
Sequence:CCGGAGAAGTCCAGACTCGTTTATCCTCGAGGATAAACGAGTCTGGACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-4847s1c1
Sequence:CCGGGCCAAGAATTGGAGAGTGTTTCTCGAGAAACACTCTCCAATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006901.1-3543s1c1
Sequence:CCGGGCCATCGTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAACGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006901.2-4308s21c1
Sequence:CCGGGAACTAGAGCAAGCTATATTTCTCGAGAAATATAGCTTGCTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173018
VALIDATED
MYO9A MISSION shRNA Bacterial Glycerol Stock
myosin IXA
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-1768s21c1
Sequence:CCGGTGGATAGTGTTTCGTATTAATCTCGAGATTAATACGAAACACTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-6223s21c1
Sequence:CCGGATCCGCTATAAAGACCTATATCTCGAGATATAGGTCTTTATAGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-8461s21c1
Sequence:CCGGTGCTCTCATTTCTAGCATTTACTCGAGTAAATGCTAGAAATGAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-2849s21c1
Sequence:CCGGTGACCCTTCAGGATCGAATTACTCGAGTAATTCGATCCTGAAGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173018.2-375s21c1
Sequence:CCGGGGTGATTGACTCCCTTATAAACTCGAGTTTATAAGGGAGTCAATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173018
VALIDATED
MYO9A MISSION shRNA shRNA Plasmid DNA
myosin IXA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-1768s21c1
Sequence:CCGGTGGATAGTGTTTCGTATTAATCTCGAGATTAATACGAAACACTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-6223s21c1
Sequence:CCGGATCCGCTATAAAGACCTATATCTCGAGATATAGGTCTTTATAGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-8461s21c1
Sequence:CCGGTGCTCTCATTTCTAGCATTTACTCGAGTAAATGCTAGAAATGAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-2849s21c1
Sequence:CCGGTGACCCTTCAGGATCGAATTACTCGAGTAATTCGATCCTGAAGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173018.2-375s21c1
Sequence:CCGGGGTGATTGACTCCCTTATAAACTCGAGTTTATAAGGGAGTCAATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173018
VALIDATED
MYO9A MISSION shRNA Lentiviral Transduction Particles
myosin IXA
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-1768s21c1
Sequence:CCGGTGGATAGTGTTTCGTATTAATCTCGAGATTAATACGAAACACTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-6223s21c1
Sequence:CCGGATCCGCTATAAAGACCTATATCTCGAGATATAGGTCTTTATAGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-8461s21c1
Sequence:CCGGTGCTCTCATTTCTAGCATTTACTCGAGTAAATGCTAGAAATGAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_173018.2-2849s21c1
Sequence:CCGGTGACCCTTCAGGATCGAATTACTCGAGTAATTCGATCCTGAAGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173018.2-375s21c1
Sequence:CCGGGGTGATTGACTCCCTTATAAACTCGAGTTTATAAGGGAGTCAATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)