EMAIL THIS PAGE TO A FRIEND

MYO9B

myosin IXB

79 Gene Product Result for
Synonyms: CELIAC4 MYR5
UniProtKB ID: Q13459, O75314, Q9NUJ2, Q9UHN0
Gene ID:
Human(4650) Summary: This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(17925) myosin IXb
Rat(25486) myosin IXb
Zebrafish(560956) myosin IXb
chicken(420135) myosin IXB
cow(513493) myosin IXB
Horse(100069995) myosin IXB
dog(484844) myosin IXB
sheep(101115874) myosin IXB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004145 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067101 MISSION® esiRNA esiRNA targeting mouse Myo9b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004145 Rosetta Predictions human pricing
NM_012984 Rosetta Predictions rat pricing
NM_015742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213047 predicted 5595
2 SASI_Hs01_00213048 predicted 6314
3 SASI_Hs01_00213049 predicted 4434
4 SASI_Hs01_00213050 predicted 5462
5 SASI_Hs01_00213051 predicted 4662
6 SASI_Hs02_00336995 predicted 5260
7 SASI_Hs01_00213052 predicted 4584
8 SASI_Hs01_00213053 predicted 5334
9 SASI_Hs01_00213054 predicted 1947
10 SASI_Hs01_00213055 predicted 900
11 SASI_Hs01_00213056 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088844 predicted 4695
2 SASI_Rn01_00088845 predicted 4479
3 SASI_Rn01_00088846 predicted 5505
4 SASI_Rn01_00088847 predicted 2343
5 SASI_Rn01_00088848 predicted 4687
6 SASI_Rn01_00088850 predicted 1227
7 SASI_Rn01_00088851 predicted 1438
8 SASI_Rn01_00088852 predicted 4464
9 SASI_Rn02_00260606 predicted 2706
10 SASI_Rn02_00260607 predicted 2523
11 SASI_Rn01_00088843 predicted 4408
12 SASI_Rn01_00088849 predicted 2103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323068 predicted 2740
2 SASI_Mm02_00323069 predicted 1618
3 SASI_Mm01_00194308 predicted 4511
4 SASI_Mm01_00194309 predicted 4727
5 SASI_Mm01_00194310 predicted 4797
6 SASI_Mm01_00194311 predicted 2581
7 SASI_Mm02_00323070 predicted 525
8 SASI_Mm02_00323071 predicted 504
9 SASI_Mm02_00323072 predicted 1266
10 SASI_Mm01_00194314 predicted 4711
11 SASI_Mm01_00194312 predicted 457
12 SASI_Mm01_00194313 predicted 4947
13 SASI_Mm01_00194315 predicted 1721
14 SASI_Mm01_00194316 predicted 5029
15 SASI_Mm01_00194317 predicted 4914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015742
MYO9B MISSION shRNA Bacterial Glycerol Stock
myosin IXB
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-2297s21c1
Sequence:CCGGGGAGAAGGCAGCAGGTATAAGCTCGAGCTTATACCTGCTGCCTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1235s21c1
Sequence:CCGGGAAGCAGCCTCAAGACTATTTCTCGAGAAATAGTCTTGAGGCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-4548s21c1
Sequence:CCGGGTGTTCCGTAAGATCACTAATCTCGAGATTAGTGATCTTACGGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1620s21c1
Sequence:CCGGTCCCTATACAGTGCCCTATTTCTCGAGAAATAGGGCACTGTATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-3886s1c1
Sequence:CCGGCCCAAAGATAAGGACAAGGATCTCGAGATCCTTGTCCTTATCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-2367s1c1
Sequence:CCGGCCGCGATTTGCATAACCAAATCTCGAGATTTGGTTATGCAAATCGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015742.1-6802s1c1
Sequence:CCGGCCAGAGAACCTTCCAGAGATTCTCGAGAATCTCTGGAAGGTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-4533s1c1
Sequence:CCGGCCGTAAGATCACTAATGCCAACTCGAGTTGGCATTAGTGATCTTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-712s1c1
Sequence:CCGGCCCTTTAAGTTCCTGCCCATTCTCGAGAATGGGCAGGAACTTAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015742
MYO9B MISSION shRNA shRNA Plasmid DNA
myosin IXB
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-2297s21c1
Sequence:CCGGGGAGAAGGCAGCAGGTATAAGCTCGAGCTTATACCTGCTGCCTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1235s21c1
Sequence:CCGGGAAGCAGCCTCAAGACTATTTCTCGAGAAATAGTCTTGAGGCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-4548s21c1
Sequence:CCGGGTGTTCCGTAAGATCACTAATCTCGAGATTAGTGATCTTACGGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1620s21c1
Sequence:CCGGTCCCTATACAGTGCCCTATTTCTCGAGAAATAGGGCACTGTATAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-3886s1c1
Sequence:CCGGCCCAAAGATAAGGACAAGGATCTCGAGATCCTTGTCCTTATCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-2367s1c1
Sequence:CCGGCCGCGATTTGCATAACCAAATCTCGAGATTTGGTTATGCAAATCGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015742.1-6802s1c1
Sequence:CCGGCCAGAGAACCTTCCAGAGATTCTCGAGAATCTCTGGAAGGTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-4533s1c1
Sequence:CCGGCCGTAAGATCACTAATGCCAACTCGAGTTGGCATTAGTGATCTTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-712s1c1
Sequence:CCGGCCCTTTAAGTTCCTGCCCATTCTCGAGAATGGGCAGGAACTTAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015742
MYO9B MISSION shRNA Lentiviral Transduction Particles
myosin IXB
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-2297s21c1
Sequence:CCGGGGAGAAGGCAGCAGGTATAAGCTCGAGCTTATACCTGCTGCCTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1235s21c1
Sequence:CCGGGAAGCAGCCTCAAGACTATTTCTCGAGAAATAGTCTTGAGGCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-4548s21c1
Sequence:CCGGGTGTTCCGTAAGATCACTAATCTCGAGATTAGTGATCTTACGGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015742.2-1620s21c1
Sequence:CCGGTCCCTATACAGTGCCCTATTTCTCGAGAAATAGGGCACTGTATAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-3886s1c1
Sequence:CCGGCCCAAAGATAAGGACAAGGATCTCGAGATCCTTGTCCTTATCTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-2367s1c1
Sequence:CCGGCCGCGATTTGCATAACCAAATCTCGAGATTTGGTTATGCAAATCGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015742.1-6802s1c1
Sequence:CCGGCCAGAGAACCTTCCAGAGATTCTCGAGAATCTCTGGAAGGTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-4533s1c1
Sequence:CCGGCCGTAAGATCACTAATGCCAACTCGAGTTGGCATTAGTGATCTTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015742.1-712s1c1
Sequence:CCGGCCCTTTAAGTTCCTGCCCATTCTCGAGAATGGGCAGGAACTTAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004145
VALIDATED
MYO9B MISSION shRNA Bacterial Glycerol Stock
myosin IXB
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-4742s21c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-3623s21c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004145.3-4382s21c1
Sequence:CCGGCGACTCTAAATCCACGTTTAACTCGAGTTAAACGTGGATTTAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-1529s21c1
Sequence:CCGGGACCGTCAACGACAAGCTTATCTCGAGATAAGCTTGTCGTTGACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-6924s21c1
Sequence:CCGGACGTGGTTTACGTAACTTTAACTCGAGTTAAAGTTACGTAAACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-3471s1c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-589s1c1
Sequence:CCGGCCCAAGTACGTGAAGATGTATCTCGAGATACATCTTCACGTACTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004145.2-4947s1c1
Sequence:CCGGCCTCTCCTATATCTGGCTCATCTCGAGATGAGCCAGATATAGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-4590s1c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-6800s1c1
Sequence:CCGGCAGCCTTAATGGAAGACCAAACTCGAGTTTGGTCTTCCATTAAGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004145
VALIDATED
MYO9B MISSION shRNA shRNA Plasmid DNA
myosin IXB
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-4742s21c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-3623s21c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004145.3-4382s21c1
Sequence:CCGGCGACTCTAAATCCACGTTTAACTCGAGTTAAACGTGGATTTAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-1529s21c1
Sequence:CCGGGACCGTCAACGACAAGCTTATCTCGAGATAAGCTTGTCGTTGACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-6924s21c1
Sequence:CCGGACGTGGTTTACGTAACTTTAACTCGAGTTAAAGTTACGTAAACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-3471s1c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-589s1c1
Sequence:CCGGCCCAAGTACGTGAAGATGTATCTCGAGATACATCTTCACGTACTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004145.2-4947s1c1
Sequence:CCGGCCTCTCCTATATCTGGCTCATCTCGAGATGAGCCAGATATAGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-4590s1c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-6800s1c1
Sequence:CCGGCAGCCTTAATGGAAGACCAAACTCGAGTTTGGTCTTCCATTAAGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004145
VALIDATED
MYO9B MISSION shRNA Lentiviral Transduction Particles
myosin IXB
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-4742s21c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-3623s21c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004145.3-4382s21c1
Sequence:CCGGCGACTCTAAATCCACGTTTAACTCGAGTTAAACGTGGATTTAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-1529s21c1
Sequence:CCGGGACCGTCAACGACAAGCTTATCTCGAGATAAGCTTGTCGTTGACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004145.3-6924s21c1
Sequence:CCGGACGTGGTTTACGTAACTTTAACTCGAGTTAAAGTTACGTAAACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-3471s1c1
Sequence:CCGGGCACGTCAAGTTCCAGAACAACTCGAGTTGTTCTGGAACTTGACGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-589s1c1
Sequence:CCGGCCCAAGTACGTGAAGATGTATCTCGAGATACATCTTCACGTACTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004145.2-4947s1c1
Sequence:CCGGCCTCTCCTATATCTGGCTCATCTCGAGATGAGCCAGATATAGGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-4590s1c1
Sequence:CCGGGCCCATTGAGAGCTTGTTTATCTCGAGATAAACAAGCTCTCAATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004145.2-6800s1c1
Sequence:CCGGCAGCCTTAATGGAAGACCAAACTCGAGTTTGGTCTTCCATTAAGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)