EMAIL THIS PAGE TO A FRIEND

MYOC

myocilin, trabecular meshwork inducible glucocorticoid response

64 Gene Product Result for
Synonyms: GLC1A GPOA JOAG JOAG1 TIGR myocilin
UniProtKB ID: Q99972, B2RD84, O00620, Q7Z6Q9
Gene ID:
Human(4653) Summary: MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. [provided by RefSeq, Jul 2008]
Mouse(17926) myocilin
Rat(81523) myocilin, trabecular meshwork inducible glucocorticoid response
chicken(424391) myocilin, trabecular meshwork inducible glucocorticoid response
dog(490344) myocilin, trabecular meshwork inducible glucocorticoid response
domestic cat(101087632) myocilin, trabecular meshwork inducible glucocorticoid response
cow(281342) myocilin, trabecular meshwork inducible glucocorticoid response
Horse(100059848) myocilin, trabecular meshwork inducible glucocorticoid response
sheep(101105836) myocilin, trabecular meshwork inducible glucocorticoid response
Domestic Rabbit(100008897) myocilin, trabecular meshwork inducible glucocorticoid response
naked mole-rat(101705679) myocilin, trabecular meshwork inducible glucocorticoid response
domestic guinea pig(100721171) myocilin, trabecular meshwork inducible glucocorticoid response
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083301 MISSION® esiRNA esiRNA human MYOC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000261 Rosetta Predictions human pricing
NM_030865 Rosetta Predictions rat pricing
XM_579496 Rosetta Predictions rat pricing
NM_010865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197091 predicted 1631
2 SASI_Hs01_00197092 predicted 657
3 SASI_Hs01_00197093 predicted 675
4 SASI_Hs01_00197094 predicted 1050
5 SASI_Hs01_00197095 predicted 1366
6 SASI_Hs01_00197096 predicted 1415
7 SASI_Hs01_00197098 predicted 420
8 SASI_Hs01_00197099 predicted 1050
9 SASI_Hs01_00197100 predicted 814
10 SASI_Hs02_00302206 predicted 948
11 SASI_Hs01_00197097 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099913 predicted 1405
2 SASI_Rn01_00099914 predicted 1261
3 SASI_Rn01_00099915 predicted 1348
4 SASI_Rn01_00099916 predicted 747
5 SASI_Rn02_00264116 predicted 1099
6 SASI_Rn01_00099917 predicted 239
7 SASI_Rn01_00099918 predicted 1463
8 SASI_Rn01_00099919 predicted 861
9 SASI_Rn01_00099920 predicted 925
10 SASI_Rn01_00099921 predicted 842
11 SASI_Rn01_00099922 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192673 predicted 738
2 SASI_Rn01_00192674 predicted 772
3 SASI_Rn01_00192675 predicted 735
4 SASI_Rn01_00192676 predicted 747
5 SASI_Rn01_00192677 predicted 744
6 SASI_Rn01_00192678 predicted 793
7 SASI_Rn01_00192679 predicted 803
8 SASI_Rn01_00192680 predicted 739
9 SASI_Rn01_00192681 predicted 730
10 SASI_Rn01_00192682 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182931 predicted 928
2 SASI_Mm01_00182932 predicted 1261
3 SASI_Mm01_00182935 predicted 962
4 SASI_Mm02_00319532 predicted 1414
5 SASI_Mm01_00182936 predicted 1192
6 SASI_Mm01_00182937 predicted 946
7 SASI_Mm01_00182938 predicted 1550
8 SASI_Mm01_00182940 predicted 1460
9 SASI_Mm02_00319533 predicted 1572
10 SASI_Mm02_00319534 predicted 485
11 SASI_Mm01_00182933 predicted 1471
12 SASI_Mm01_00182934 predicted 1403
13 SASI_Mm01_00182939 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010865
MYOC MISSION shRNA Bacterial Glycerol Stock
myocilin, trabecular meshwork inducible glucocorticoid response
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010865.2-1874s1c1
Sequence:CCGGGCACGCTGTTATGGTTACCATCTCGAGATGGTAACCATAACAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-220s1c1
Sequence:CCGGCCAATGAATCTAGCTGCCCAACTCGAGTTGGGCAGCTAGATTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-1445s1c1
Sequence:CCGGCATCCCATTCACGAATCGCTACTCGAGTAGCGATTCGTGAATGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-471s1c1
Sequence:CCGGGCAGCCTATAACAATCTCCTTCTCGAGAAGGAGATTGTTATAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-488s1c1
Sequence:CCGGCCTTCGAGATAAGTCGGCTTTCTCGAGAAAGCCGACTTATCTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010865
MYOC MISSION shRNA shRNA Plasmid DNA
myocilin, trabecular meshwork inducible glucocorticoid response
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010865.2-1874s1c1
Sequence:CCGGGCACGCTGTTATGGTTACCATCTCGAGATGGTAACCATAACAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-220s1c1
Sequence:CCGGCCAATGAATCTAGCTGCCCAACTCGAGTTGGGCAGCTAGATTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-1445s1c1
Sequence:CCGGCATCCCATTCACGAATCGCTACTCGAGTAGCGATTCGTGAATGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-471s1c1
Sequence:CCGGGCAGCCTATAACAATCTCCTTCTCGAGAAGGAGATTGTTATAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-488s1c1
Sequence:CCGGCCTTCGAGATAAGTCGGCTTTCTCGAGAAAGCCGACTTATCTCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010865
MYOC MISSION shRNA Lentiviral Transduction Particles
myocilin, trabecular meshwork inducible glucocorticoid response
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010865.2-1874s1c1
Sequence:CCGGGCACGCTGTTATGGTTACCATCTCGAGATGGTAACCATAACAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-220s1c1
Sequence:CCGGCCAATGAATCTAGCTGCCCAACTCGAGTTGGGCAGCTAGATTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-1445s1c1
Sequence:CCGGCATCCCATTCACGAATCGCTACTCGAGTAGCGATTCGTGAATGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-471s1c1
Sequence:CCGGGCAGCCTATAACAATCTCCTTCTCGAGAAGGAGATTGTTATAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010865.2-488s1c1
Sequence:CCGGCCTTCGAGATAAGTCGGCTTTCTCGAGAAAGCCGACTTATCTCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000261
MYOC MISSION shRNA Bacterial Glycerol Stock
myocilin, trabecular meshwork inducible glucocorticoid response
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000261.1-1686s1c1
Sequence:CCGGCCATCTAACTATTCAGGAATTCTCGAGAATTCCTGAATAGTTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-789s1c1
Sequence:CCGGCGCTGAGAACAGCAGAAACAACTCGAGTTGTTTCTGCTGTTCTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1429s1c1
Sequence:CCGGCCGCTATAAGTACAGCAGCATCTCGAGATGCTGCTGTACTTATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1361s1c1
Sequence:CCGGGCTACCGTCAACTTTGCTTATCTCGAGATAAGCAAAGTTGACGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1244s1c1
Sequence:CCGGCCAGAGAATCTGGAACTCGAACTCGAGTTCGAGTTCCAGATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-622s21c1
Sequence:CCGGAGAAGTTTCTACGTGGAATTTCTCGAGAAATTCCACGTAGAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1116s21c1
Sequence:CCGGACCACGGACAGTTCCCGTATTCTCGAGAATACGGGAACTGTCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1177s21c1
Sequence:CCGGAGCAGGCCTCTGGGTCATTTACTCGAGTAAATGACCCAGAGGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000261
MYOC MISSION shRNA shRNA Plasmid DNA
myocilin, trabecular meshwork inducible glucocorticoid response
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000261.1-1686s1c1
Sequence:CCGGCCATCTAACTATTCAGGAATTCTCGAGAATTCCTGAATAGTTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-789s1c1
Sequence:CCGGCGCTGAGAACAGCAGAAACAACTCGAGTTGTTTCTGCTGTTCTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1429s1c1
Sequence:CCGGCCGCTATAAGTACAGCAGCATCTCGAGATGCTGCTGTACTTATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1361s1c1
Sequence:CCGGGCTACCGTCAACTTTGCTTATCTCGAGATAAGCAAAGTTGACGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1244s1c1
Sequence:CCGGCCAGAGAATCTGGAACTCGAACTCGAGTTCGAGTTCCAGATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-622s21c1
Sequence:CCGGAGAAGTTTCTACGTGGAATTTCTCGAGAAATTCCACGTAGAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1116s21c1
Sequence:CCGGACCACGGACAGTTCCCGTATTCTCGAGAATACGGGAACTGTCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1177s21c1
Sequence:CCGGAGCAGGCCTCTGGGTCATTTACTCGAGTAAATGACCCAGAGGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000261
MYOC MISSION shRNA Lentiviral Transduction Particles
myocilin, trabecular meshwork inducible glucocorticoid response
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000261.1-1686s1c1
Sequence:CCGGCCATCTAACTATTCAGGAATTCTCGAGAATTCCTGAATAGTTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-789s1c1
Sequence:CCGGCGCTGAGAACAGCAGAAACAACTCGAGTTGTTTCTGCTGTTCTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1429s1c1
Sequence:CCGGCCGCTATAAGTACAGCAGCATCTCGAGATGCTGCTGTACTTATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1361s1c1
Sequence:CCGGGCTACCGTCAACTTTGCTTATCTCGAGATAAGCAAAGTTGACGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000261.1-1244s1c1
Sequence:CCGGCCAGAGAATCTGGAACTCGAACTCGAGTTCGAGTTCCAGATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-622s21c1
Sequence:CCGGAGAAGTTTCTACGTGGAATTTCTCGAGAAATTCCACGTAGAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1116s21c1
Sequence:CCGGACCACGGACAGTTCCCGTATTCTCGAGAATACGGGAACTGTCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000261.1-1177s21c1
Sequence:CCGGAGCAGGCCTCTGGGTCATTTACTCGAGTAAATGACCCAGAGGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)