EMAIL THIS PAGE TO A FRIEND

MYOCD

myocardin

68 Gene Product Result for
Synonyms: MYCD
UniProtKB ID: Q8IZQ8, Q5UBU5, Q8N7Q1
Gene ID:
Human(93649) Summary: This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(214384) myocardin
Rat(246297) myocardin
sheep(101104413) myocardin
sheep(100302331) myocardin
chicken(427790) myocardin
dog(489509) myocardin
Horse(100073100) myocardin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200539 Anti-Myocardin antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
M8948 Monoclonal Anti-Myocardin antibody produced in mouse ~2.0 mg/mL, clone MCR54, purified immunoglobulin human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153604 Rosetta Predictions human pricing
NM_182667 Rosetta Predictions rat pricing
NM_145136 Rosetta Predictions mouse pricing
NM_146386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367327 predicted 2412
2 SASI_Hs01_00165365 predicted 2132
3 SASI_Hs02_00367328 predicted 1241
4 SASI_Hs01_00165366 predicted 2403
5 SASI_Hs02_00367329 predicted 2500
6 SASI_Hs02_00367330 predicted 585
7 SASI_Hs01_00165369 predicted 238
8 SASI_Hs01_00165371 predicted 218
9 SASI_Hs02_00367331 predicted 2243
10 SASI_Hs02_00367332 predicted 2420
11 SASI_Hs01_00165364 predicted 2416
12 SASI_Hs01_00165367 predicted 596
13 SASI_Hs01_00165368 predicted 2547
14 SASI_Hs01_00165370 predicted 2404
15 SASI_Hs01_00165372 predicted 1657
16 SASI_Hs01_00165373 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118674 predicted 2506
2 SASI_Rn01_00118675 predicted 1488
3 SASI_Rn01_00118676 predicted 2884
4 SASI_Rn01_00118677 predicted 2290
5 SASI_Rn01_00118678 predicted 260
6 SASI_Rn01_00118679 predicted 1893
7 SASI_Rn01_00118680 predicted 1807
8 SASI_Rn01_00118681 predicted 2402
9 SASI_Rn01_00118682 predicted 2511
10 SASI_Rn01_00118683 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340526 predicted 325
2 SASI_Mm01_00140868 predicted 1524
3 SASI_Mm01_00140869 predicted 395
4 SASI_Mm01_00140870 predicted 308
5 SASI_Mm02_00340527 predicted 744
6 SASI_Mm02_00340528 predicted 673
7 SASI_Mm02_00340529 predicted 548
8 SASI_Mm01_00140876 predicted 1848
9 SASI_Mm02_00340530 predicted 2687
10 SASI_Mm02_00340531 predicted 2844
11 SASI_Mm01_00140871 predicted 1588
12 SASI_Mm01_00140872 predicted 868
13 SASI_Mm01_00140873 predicted 1626
14 SASI_Mm01_00140874 predicted 3043
15 SASI_Mm01_00140875 predicted 328
16 SASI_Mm01_00140877 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342130 predicted 327
2 SASI_Mm01_00096624 predicted 1524
3 SASI_Mm01_00096625 predicted 399
4 SASI_Mm01_00096626 predicted 303
5 SASI_Mm02_00342131 predicted 739
6 SASI_Mm02_00342132 predicted 674
7 SASI_Mm02_00342133 predicted 551
8 SASI_Mm01_00096632 predicted 1848
9 SASI_Mm02_00342134 predicted 2538
10 SASI_Mm02_00342135 predicted 2697
11 SASI_Mm01_00096627 predicted 1559
12 SASI_Mm01_00096628 predicted 841
13 SASI_Mm01_00096629 predicted 1605
14 SASI_Mm01_00096630 predicted 2871
15 SASI_Mm01_00096631 predicted 300
16 SASI_Mm01_00096633 predicted 2879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153604
MYOCD MISSION shRNA Bacterial Glycerol Stock
myocardin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3036s21c1
Sequence:CCGGAGCATCTTCAACATCGATTTCCTCGAGGAAATCGATGTTGAAGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2229s1c1
Sequence:CCGGGCTTATTGAAAGCGGAGAAATCTCGAGATTTCTCCGCTTTCAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2410s1c1
Sequence:CCGGGATGAGCATCTTGAAGTCTTACTCGAGTAAGACTTCAAGATGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2161s1c1
Sequence:CCGGCCATCCTATGAAGATGCCGTACTCGAGTACGGCATCTTCATAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3058s21c1
Sequence:CCGGTGGATGTCACTGATCTCAATTCTCGAGAATTGAGATCAGTGACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-94s1c1
Sequence:CCGGCAACTGGCTAACCAAGGCATACTCGAGTATGCCTTGGTTAGCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-225s1c1
Sequence:CCGGCGACTTGGTTAATATGCACATCTCGAGATGTGCATATTAACCAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-964s1c1
Sequence:CCGGCAGCTTAAGGAACCAAATGAACTCGAGTTCATTTGGTTCCTTAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153604
MYOCD MISSION shRNA shRNA Plasmid DNA
myocardin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3036s21c1
Sequence:CCGGAGCATCTTCAACATCGATTTCCTCGAGGAAATCGATGTTGAAGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2229s1c1
Sequence:CCGGGCTTATTGAAAGCGGAGAAATCTCGAGATTTCTCCGCTTTCAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2410s1c1
Sequence:CCGGGATGAGCATCTTGAAGTCTTACTCGAGTAAGACTTCAAGATGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2161s1c1
Sequence:CCGGCCATCCTATGAAGATGCCGTACTCGAGTACGGCATCTTCATAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3058s21c1
Sequence:CCGGTGGATGTCACTGATCTCAATTCTCGAGAATTGAGATCAGTGACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-94s1c1
Sequence:CCGGCAACTGGCTAACCAAGGCATACTCGAGTATGCCTTGGTTAGCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-225s1c1
Sequence:CCGGCGACTTGGTTAATATGCACATCTCGAGATGTGCATATTAACCAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-964s1c1
Sequence:CCGGCAGCTTAAGGAACCAAATGAACTCGAGTTCATTTGGTTCCTTAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153604
MYOCD MISSION shRNA Lentiviral Transduction Particles
myocardin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3036s21c1
Sequence:CCGGAGCATCTTCAACATCGATTTCCTCGAGGAAATCGATGTTGAAGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2229s1c1
Sequence:CCGGGCTTATTGAAAGCGGAGAAATCTCGAGATTTCTCCGCTTTCAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2410s1c1
Sequence:CCGGGATGAGCATCTTGAAGTCTTACTCGAGTAAGACTTCAAGATGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-2161s1c1
Sequence:CCGGCCATCCTATGAAGATGCCGTACTCGAGTACGGCATCTTCATAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153604.2-3058s21c1
Sequence:CCGGTGGATGTCACTGATCTCAATTCTCGAGAATTGAGATCAGTGACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-94s1c1
Sequence:CCGGCAACTGGCTAACCAAGGCATACTCGAGTATGCCTTGGTTAGCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-225s1c1
Sequence:CCGGCGACTTGGTTAATATGCACATCTCGAGATGTGCATATTAACCAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153604.1-964s1c1
Sequence:CCGGCAGCTTAAGGAACCAAATGAACTCGAGTTCATTTGGTTCCTTAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145136
MYOCD MISSION shRNA Bacterial Glycerol Stock
myocardin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-1598s21c1
Sequence:CCGGCCAACACCTTGCCCAGTTATCCTCGAGGATAACTGGGCAAGGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145136.4-3395s21c1
Sequence:CCGGCAAACAGAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-684s21c1
Sequence:CCGGTTCCGTGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCACGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1980s1c1
Sequence:CCGGCCTCATTGAAAGTGGAGAAATCTCGAGATTTCTCCACTTTCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1791s1c1
Sequence:CCGGCCCAAGTATTCATCCAAAGATCTCGAGATCTTTGGATGAATACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-71s1c1
Sequence:CCGGCCTTTGAGGATGACAGCAGTACTCGAGTACTGCTGTCATCCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-2396s1c1
Sequence:CCGGTCACGGAATCTCCTTGGGAAACTCGAGTTTCCCAAGGAGATTCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-376s1c1
Sequence:CCGGCCAAAGGTGAAGAAGCTCAAACTCGAGTTTGAGCTTCTTCACCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145136
MYOCD MISSION shRNA shRNA Plasmid DNA
myocardin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-1598s21c1
Sequence:CCGGCCAACACCTTGCCCAGTTATCCTCGAGGATAACTGGGCAAGGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145136.4-3395s21c1
Sequence:CCGGCAAACAGAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-684s21c1
Sequence:CCGGTTCCGTGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCACGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1980s1c1
Sequence:CCGGCCTCATTGAAAGTGGAGAAATCTCGAGATTTCTCCACTTTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1791s1c1
Sequence:CCGGCCCAAGTATTCATCCAAAGATCTCGAGATCTTTGGATGAATACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-71s1c1
Sequence:CCGGCCTTTGAGGATGACAGCAGTACTCGAGTACTGCTGTCATCCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-2396s1c1
Sequence:CCGGTCACGGAATCTCCTTGGGAAACTCGAGTTTCCCAAGGAGATTCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-376s1c1
Sequence:CCGGCCAAAGGTGAAGAAGCTCAAACTCGAGTTTGAGCTTCTTCACCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145136
MYOCD MISSION shRNA Lentiviral Transduction Particles
myocardin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-1598s21c1
Sequence:CCGGCCAACACCTTGCCCAGTTATCCTCGAGGATAACTGGGCAAGGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145136.4-3395s21c1
Sequence:CCGGCAAACAGAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145136.4-684s21c1
Sequence:CCGGTTCCGTGAAAGAGGCTATAAACTCGAGTTTATAGCCTCTTTCACGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1980s1c1
Sequence:CCGGCCTCATTGAAAGTGGAGAAATCTCGAGATTTCTCCACTTTCAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-1791s1c1
Sequence:CCGGCCCAAGTATTCATCCAAAGATCTCGAGATCTTTGGATGAATACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-71s1c1
Sequence:CCGGCCTTTGAGGATGACAGCAGTACTCGAGTACTGCTGTCATCCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-2396s1c1
Sequence:CCGGTCACGGAATCTCCTTGGGAAACTCGAGTTTCCCAAGGAGATTCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145136.1-376s1c1
Sequence:CCGGCCAAAGGTGAAGAAGCTCAAACTCGAGTTTGAGCTTCTTCACCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)