EMAIL THIS PAGE TO A FRIEND

MYOD1

myogenic differentiation 1

86 Gene Product Result for
Synonyms: MYF3 MYOD PUM bHLHc1
UniProtKB ID: P15172, O75321
Gene ID:
Human(4654) Summary: This gene encodes a nuclear protein that belongs to the basic helix-loop-helix family of transcription factors and the myogenic factors subfamily. It regulates muscle cell differentiation by inducing cell cycle arrest, a prerequisite for myogenic initiation. The protein is also involved in muscle regeneration. It activates its own transcription which may stabilize commitment to myogenesis. [provided by RefSeq, Jul 2008]
Mouse(17927) myogenic differentiation 1
Rat(337868) myogenic differentiation 1
sheep(443405) myogenic differentiation 1
naked mole-rat(101707846) myogenic differentiation 1
domestic guinea pig(100717629) myogenic differentiation 1
Zebrafish(30513) myogenic differentiation 1
dog(611940) myogenic differentiation 1
Horse(100071803) myogenic differentiation 1
cow(281938) myogenic differentiation 1
domestic cat(101097667) myogenic differentiation 1
chicken(374048) myogenic differentiation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300397 Anti-MYOD1 (Ab-200) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB2702415 Anti-myod1 antibody produced in rabbit affinity isolated antibody zebrafish
immunohistochemistry pricing
SAB2105139 Anti-MYOD1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA051362 Anti-MYOD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410813 Anti-MYOD1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB4503943 Anti-phospho-MYOD (pSer200) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300059 Anti-phospho-MYOD1 (pSer200) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
M6190 Monoclonal Anti-MYOD1 antibody produced in mouse clone 5.2F, purified immunoglobulin, buffered aqueous solution human, chicken, mouse, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
WH0004654M1 Monoclonal Anti-MYOD1 antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300415 Monoclonal Anti-MYOD1 antibody produced in mouse clone 1C8, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002478 Rosetta Predictions human pricing
NM_176079 Rosetta Predictions rat pricing
NM_010866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233104 predicted 1541
2 SASI_Hs01_00233106 predicted 1260
3 SASI_Hs01_00233107 predicted 1569
4 SASI_Hs01_00233108 predicted 1553
5 SASI_Hs01_00233110 predicted 1153
6 SASI_Hs01_00233111 predicted 1338
7 SASI_Hs01_00233112 predicted 296
8 SASI_Hs01_00233113 predicted 283
9 SASI_Hs02_00333906 predicted 1377
10 SASI_Hs02_00333907 predicted 284
11 SASI_Hs01_00233105 predicted 1478
12 SASI_Hs01_00233109 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079662 predicted 818
2 SASI_Rn01_00079663 predicted 317
3 SASI_Rn01_00079664 predicted 292
4 SASI_Rn01_00079666 predicted 623
5 SASI_Rn01_00079667 predicted 1127
6 SASI_Rn01_00079668 predicted 1127
7 SASI_Rn01_00079669 predicted 292
8 SASI_Rn01_00079670 predicted 527
9 SASI_Rn01_00079671 predicted 646
10 SASI_Rn02_00269562 predicted 878
11 SASI_Rn01_00079665 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319535 predicted 808
2 SASI_Mm01_00143498 predicted 764
3 SASI_Mm01_00143496 predicted 1592
4 SASI_Mm01_00143501 predicted 616
5 SASI_Mm02_00319536 predicted 284
6 SASI_Mm02_00319537 predicted 1583
7 SASI_Mm02_00319538 predicted 808
8 SASI_Mm02_00319539 predicted 866
9 SASI_Mm02_00319540 predicted 948
10 SASI_Mm02_00319541 predicted 666
11 SASI_Mm01_00143494 predicted 1212
12 SASI_Mm01_00143495 predicted 286
13 SASI_Mm01_00143497 predicted 1253
14 SASI_Mm01_00143499 predicted 1046
15 SASI_Mm01_00143500 predicted 273
16 SASI_Mm01_00143502 predicted 1427
17 SASI_Mm01_00143503 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010866
MYOD1 MISSION shRNA Bacterial Glycerol Stock
myogenic differentiation 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000086563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010866.1-1361s1c1
Sequence:CCGGCCTTCAGTTGTTTGTTTGTTTCTCGAGAAACAAACAAACAACTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-1126s1c1
Sequence:CCGGATGCGATTTATCAGGTGCTTTCTCGAGAAAGCACCTGATAAATCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-257s1c1
Sequence:CCGGCTTTGAGACAGCAGACGACTTCTCGAGAAGTCGTCTGCTGTCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-274s1c1
Sequence:CCGGACTTCTATGATGATCCGTGTTCTCGAGAACACGGATCATCATAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010866
MYOD1 MISSION shRNA shRNA Plasmid DNA
myogenic differentiation 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000086563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010866.1-1361s1c1
Sequence:CCGGCCTTCAGTTGTTTGTTTGTTTCTCGAGAAACAAACAAACAACTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-1126s1c1
Sequence:CCGGATGCGATTTATCAGGTGCTTTCTCGAGAAAGCACCTGATAAATCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-257s1c1
Sequence:CCGGCTTTGAGACAGCAGACGACTTCTCGAGAAGTCGTCTGCTGTCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-274s1c1
Sequence:CCGGACTTCTATGATGATCCGTGTTCTCGAGAACACGGATCATCATAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010866
MYOD1 MISSION shRNA Lentiviral Transduction Particles
myogenic differentiation 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000086563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010866.1-1361s1c1
Sequence:CCGGCCTTCAGTTGTTTGTTTGTTTCTCGAGAAACAAACAAACAACTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-1126s1c1
Sequence:CCGGATGCGATTTATCAGGTGCTTTCTCGAGAAAGCACCTGATAAATCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-257s1c1
Sequence:CCGGCTTTGAGACAGCAGACGACTTCTCGAGAAGTCGTCTGCTGTCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010866.1-274s1c1
Sequence:CCGGACTTCTATGATGATCCGTGTTCTCGAGAACACGGATCATCATAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002478
MYOD1 MISSION shRNA Bacterial Glycerol Stock
myogenic differentiation 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002478.3-1598s1c1
Sequence:CCGGCCTGTAAATAAGAGTTGCTTTCTCGAGAAAGCAACTCTTATTTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-237s1c1
Sequence:CCGGCTTTGCCACAACGGACGACTTCTCGAGAAGTCGTCCGTTGTGGCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-791s1c1
Sequence:CCGGCCGACGGCATGATGGACTACACTCGAGTGTAGTCCATCATGCCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-254s1c1
Sequence:CCGGACTTCTATGACGACCCGTGTTCTCGAGAACACGGGTCGTCATAGAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-537s1c1
Sequence:CCGGGAGCAAAGTAAATGAGGCCTTCTCGAGAAGGCCTCATTTACTTTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002478
MYOD1 MISSION shRNA shRNA Plasmid DNA
myogenic differentiation 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002478.3-1598s1c1
Sequence:CCGGCCTGTAAATAAGAGTTGCTTTCTCGAGAAAGCAACTCTTATTTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-237s1c1
Sequence:CCGGCTTTGCCACAACGGACGACTTCTCGAGAAGTCGTCCGTTGTGGCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-791s1c1
Sequence:CCGGCCGACGGCATGATGGACTACACTCGAGTGTAGTCCATCATGCCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-254s1c1
Sequence:CCGGACTTCTATGACGACCCGTGTTCTCGAGAACACGGGTCGTCATAGAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-537s1c1
Sequence:CCGGGAGCAAAGTAAATGAGGCCTTCTCGAGAAGGCCTCATTTACTTTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002478
MYOD1 MISSION shRNA Lentiviral Transduction Particles
myogenic differentiation 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002478.3-1598s1c1
Sequence:CCGGCCTGTAAATAAGAGTTGCTTTCTCGAGAAAGCAACTCTTATTTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-237s1c1
Sequence:CCGGCTTTGCCACAACGGACGACTTCTCGAGAAGTCGTCCGTTGTGGCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-791s1c1
Sequence:CCGGCCGACGGCATGATGGACTACACTCGAGTGTAGTCCATCATGCCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-254s1c1
Sequence:CCGGACTTCTATGACGACCCGTGTTCTCGAGAACACGGGTCGTCATAGAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002478.3-537s1c1
Sequence:CCGGGAGCAAAGTAAATGAGGCCTTCTCGAGAAGGCCTCATTTACTTTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)