EMAIL THIS PAGE TO A FRIEND

MYOF

myoferlin

101 Gene Product Result for
Synonyms: FER1L3
Gene ID:
Human(26509) Summary: Mutations in dysferlin, a protein associated with the plasma membrane, can cause muscle weakness that affects both proximal and distal muscles. The protein encoded by this gene is a type II membrane protein that is structurally similar to dysferlin. It is a member of the ferlin family and associates with both plasma and nuclear membranes. The protein contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. Two transcript variants encoding different isoforms have been found for this gene. Other possible variants have been detected, but their full-length nature has not been determined. [provided by RefSeq, Dec 2008]
Mouse(226101) myoferlin
Rat(309499) myoferlin
Zebrafish(559066) myoferlin
cow(513597) myoferlin
Horse(100071199) myoferlin
dog(607472) myoferlin
chicken(423805) myoferlin
Zebrafish(393849) myoferlin
sheep(101104107) myoferlin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108133 Anti-FER1L3 antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, rat, mouse, horse
western blot pricing
SAB2100809 Anti-FER1L3 antibody produced in rabbit affinity isolated antibody, lyophilized powder chicken, human, rabbit, mouse, rat, horse
western blot pricing
HPA014245 Anti-MYOF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_283556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013451 Rosetta Predictions human pricing
NM_133337 Rosetta Predictions human pricing
XM_001080627 Rosetta Predictions rat pricing
XM_220031 Rosetta Predictions rat pricing
NM_001099634 Rosetta Predictions mouse pricing
XM_001480162 Rosetta Predictions mouse pricing
XM_001480167 Rosetta Predictions mouse pricing
XM_283556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111714 predicted 5688
2 SASI_Hs01_00111715 predicted 3076
3 SASI_Hs01_00111716 predicted 3238
4 SASI_Hs01_00111717 predicted 2134
5 SASI_Hs02_00344865 predicted 4962
6 SASI_Hs02_00344866 predicted 1880
7 SASI_Hs01_00111718 predicted 3524
8 SASI_Hs01_00111720 predicted 1128
9 SASI_Hs01_00111721 predicted 690
10 SASI_Hs01_00111722 predicted 2713
11 SASI_Hs01_00111719 predicted 712
12 SASI_Hs01_00111723 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171554 predicted 5656
2 SASI_Hs01_00171555 predicted 3034
3 SASI_Hs01_00171556 predicted 3194
4 SASI_Hs02_00363034 predicted 2091
5 SASI_Hs02_00363035 predicted 4922
6 SASI_Hs02_00363036 predicted 1843
7 SASI_Hs01_00171557 predicted 3490
8 SASI_Hs01_00171559 predicted 1128
9 SASI_Hs01_00171560 predicted 698
10 SASI_Hs01_00171561 predicted 2673
11 SASI_Hs01_00171553 predicted 541
12 SASI_Hs01_00171558 predicted 713
13 SASI_Hs01_00171562 predicted 4619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368700 predicted 3412
2 SASI_Rn02_00368701 predicted 2116
3 SASI_Rn02_00368702 predicted 2887
4 SASI_Rn02_00368703 predicted 6200
5 SASI_Rn02_00368704 predicted 1912
6 SASI_Rn02_00368705 predicted 3114
7 SASI_Rn02_00368706 predicted 6069
8 SASI_Rn02_00368707 predicted 1878
9 SASI_Rn02_00368708 predicted 1963
10 SASI_Rn02_00368709 predicted 3769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378945 predicted 3399
2 SASI_Rn02_00378946 predicted 2106
3 SASI_Rn02_00378947 predicted 2133
4 SASI_Rn02_00378948 predicted 6237
5 SASI_Rn02_00378949 predicted 1905
6 SASI_Rn02_00378950 predicted 3118
7 SASI_Rn02_00378951 predicted 6104
8 SASI_Rn02_00378952 predicted 1866
9 SASI_Rn02_00378953 predicted 1951
10 SASI_Rn02_00378954 predicted 3745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301885 predicted 5324
2 SASI_Mm02_00301886 predicted 6371
3 SASI_Mm02_00301887 predicted 2047
4 SASI_Mm02_00301888 predicted 2028
5 SASI_Mm02_00301889 predicted 703
6 SASI_Mm02_00301890 predicted 6248
7 SASI_Mm02_00301891 predicted 3834
8 SASI_Mm02_00301892 predicted 3998
9 SASI_Mm02_00301893 predicted 2143
10 SASI_Mm02_00301894 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415490 predicted 5073
2 SASI_Mm02_00415491 predicted 6127
3 SASI_Mm02_00415492 predicted 1795
4 SASI_Mm02_00415493 predicted 1782
5 SASI_Mm02_00415494 predicted 448
6 SASI_Mm02_00415495 predicted 5989
7 SASI_Mm02_00415496 predicted 3582
8 SASI_Mm02_00415497 predicted 3747
9 SASI_Mm02_00415498 predicted 1886
10 SASI_Mm02_00415499 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415534 predicted 5112
2 SASI_Mm02_00415535 predicted 6166
3 SASI_Mm02_00415536 predicted 1842
4 SASI_Mm02_00415537 predicted 1818
5 SASI_Mm02_00415538 predicted 448
6 SASI_Mm02_00415539 predicted 6034
7 SASI_Mm02_00415540 predicted 3624
8 SASI_Mm02_00415541 predicted 3784
9 SASI_Mm02_00415542 predicted 1931
10 SASI_Mm02_00415543 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246847 predicted 6404
2 SASI_Mm01_00246848 predicted 6414
3 SASI_Mm01_00246849 predicted 2131
4 SASI_Mm01_00246850 predicted 2096
5 SASI_Mm01_00246851 predicted 2072
6 SASI_Mm01_00246852 predicted 713
7 SASI_Mm01_00246853 predicted 6294
8 SASI_Mm01_00246854 predicted 3884
9 SASI_Mm01_00246855 predicted 4042
10 SASI_Mm01_00246856 predicted 2181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283556
VALIDATED
MYOF MISSION shRNA Bacterial Glycerol Stock
myoferlin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-361s1c1
Sequence:CCGGGAACAGGTCTTTGCCCTACAACTCGAGTTGTAGGGCAAAGACCTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-766s1c1
Sequence:CCGGCACGAGAATCAAGAGAGGGAACTCGAGTTCCCTCTCTTGATTCTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-879s1c1
Sequence:CCGGCCCATTCTTTGAGGGCAGATTCTCGAGAATCTGCCCTCAAAGAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-137s1c1
Sequence:CCGGGATCCTATCGTTTCTGTCATTCTCGAGAATGACAGAAACGATAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-700s1c1
Sequence:CCGGCCGTCAGTTATGCGGCAACAACTCGAGTTGTTGCCGCATAACTGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283556
VALIDATED
MYOF MISSION shRNA shRNA Plasmid DNA
myoferlin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-361s1c1
Sequence:CCGGGAACAGGTCTTTGCCCTACAACTCGAGTTGTAGGGCAAAGACCTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-766s1c1
Sequence:CCGGCACGAGAATCAAGAGAGGGAACTCGAGTTCCCTCTCTTGATTCTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-879s1c1
Sequence:CCGGCCCATTCTTTGAGGGCAGATTCTCGAGAATCTGCCCTCAAAGAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-137s1c1
Sequence:CCGGGATCCTATCGTTTCTGTCATTCTCGAGAATGACAGAAACGATAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-700s1c1
Sequence:CCGGCCGTCAGTTATGCGGCAACAACTCGAGTTGTTGCCGCATAACTGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283556
VALIDATED
MYOF MISSION shRNA Lentiviral Transduction Particles
myoferlin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-361s1c1
Sequence:CCGGGAACAGGTCTTTGCCCTACAACTCGAGTTGTAGGGCAAAGACCTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-766s1c1
Sequence:CCGGCACGAGAATCAAGAGAGGGAACTCGAGTTCCCTCTCTTGATTCTCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-879s1c1
Sequence:CCGGCCCATTCTTTGAGGGCAGATTCTCGAGAATCTGCCCTCAAAGAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-137s1c1
Sequence:CCGGGATCCTATCGTTTCTGTCATTCTCGAGAATGACAGAAACGATAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_283556.2-700s1c1
Sequence:CCGGCCGTCAGTTATGCGGCAACAACTCGAGTTGTTGCCGCATAACTGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013451
VALIDATED
MYOF MISSION shRNA Bacterial Glycerol Stock
myoferlin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-6220s1c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013451.x-6666s1c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-5195s1c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-5230s21c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-6255s21c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-2983s21c1
Sequence:CCGGACGGATGCGAACGGCGATAAACTCGAGTTTATCGCCGTTCGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013451.3-6701s21c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013451
VALIDATED
MYOF MISSION shRNA shRNA Plasmid DNA
myoferlin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-6220s1c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013451.x-6666s1c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-5195s1c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-5230s21c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-6255s21c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-2983s21c1
Sequence:CCGGACGGATGCGAACGGCGATAAACTCGAGTTTATCGCCGTTCGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013451.3-6701s21c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013451
VALIDATED
MYOF MISSION shRNA Lentiviral Transduction Particles
myoferlin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-6220s1c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013451.x-6666s1c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013451.x-5195s1c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-5230s21c1
Sequence:CCGGCGAGACTACAGCTTGGATGAACTCGAGTTCATCCAAGCTGTAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-6255s21c1
Sequence:CCGGCCTCTACTCTTTGCCGAACTACTCGAGTAGTTCGGCAAAGAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013451.3-2983s21c1
Sequence:CCGGACGGATGCGAACGGCGATAAACTCGAGTTTATCGCCGTTCGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013451.3-6701s21c1
Sequence:CCGGGAAAGAGCTGTGCATTATAAACTCGAGTTTATAATGCACAGCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)