EMAIL THIS PAGE TO A FRIEND

MYOG

myogenin (myogenic factor 4)

108 Gene Product Result for
Synonyms: MYF4 bHLHc3 myf-4
UniProtKB ID: P15173, Q53XW6
Gene ID:
Human(4656) Summary: Myogenin is a muscle-specific transcription factor that can induce myogenesis in a variety of cell types in tissue culture. It is a member of a large family of proteins related by sequence homology, the helix-loop-helix (HLH) proteins. It is essential for the development of functional skeletal muscle. [provided by RefSeq, Jul 2008]
Mouse(17928) myogenin
Rat(29148) myogenin
Goat(100861395) myogenin (myogenic factor 4)
sheep(443158) myogenin (myogenic factor 4)
Domestic Rabbit(100415937) myogenin (myogenic factor 4)
naked mole-rat(101706331) myogenin (myogenic factor 4)
domestic guinea pig(100727419) myogenin (myogenic factor 4)
Zebrafish(30200) myogenin
domestic cat(101100276) myogenin (myogenic factor 4)
cow(281343) myogenin (myogenic factor 4)
dog(490224) myogenin (myogenic factor 4)
chicken(374004) myogenin (myogenic factor 4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105034 Anti-MYOG (31-45) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105035 Anti-MYOG (73-85) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2501587 Anti-MYOG (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, pig, rat, bovine
ELISA, western blot pricing
HPA038093 Anti-MYOG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410814 Anti-MYOG antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
HPA028336 Anti-MYOG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1305721 ANTI-MYOGENIN(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
WH0004656M1 Monoclonal Anti-MYOG antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404106 Monoclonal Anti-MYOG antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409339 Monoclonal Anti-MYOG antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
M5815 Monoclonal Anti-Myogenin antibody produced in mouse clone F12B, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002479 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138681 MISSION® esiRNA esiRNA human MYOG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002479 Rosetta Predictions human pricing
NM_017115 Rosetta Predictions rat pricing
NM_031189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333908 predicted 902
2 SASI_Hs01_00168232 predicted 487
3 SASI_Hs01_00168233 predicted 999
4 SASI_Hs01_00168234 predicted 1139
5 SASI_Hs01_00168235 predicted 1102
6 SASI_Hs01_00168236 predicted 553
7 SASI_Hs02_00333909 predicted 379
8 SASI_Hs01_00168237 predicted 1355
9 SASI_Hs01_00168238 predicted 578
10 SASI_Hs01_00168239 predicted 636
11 SASI_Hs01_00168240 predicted 870
12 SASI_Hs01_00168241 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060600 predicted 406
2 SASI_Rn01_00060601 predicted 623
3 SASI_Rn01_00060602 predicted 682
4 SASI_Rn01_00060603 predicted 233
5 SASI_Rn01_00060604 predicted 648
6 SASI_Rn02_00261351 predicted 296
7 SASI_Rn01_00060605 predicted 616
8 SASI_Rn01_00060606 predicted 496
9 SASI_Rn02_00261352 predicted 751
10 SASI_Rn01_00060608 predicted 741
11 SASI_Rn01_00060607 predicted 678
12 SASI_Rn01_00060609 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027333 predicted 696
2 SASI_Mm01_00027334 predicted 426
3 SASI_Mm01_00027335 predicted 630
4 SASI_Mm01_00027336 predicted 899
5 SASI_Mm01_00027337 predicted 716
6 SASI_Mm01_00027338 predicted 668
7 SASI_Mm01_00027339 predicted 645
8 SASI_Mm01_00027340 predicted 384
9 SASI_Mm01_00027341 predicted 692
10 SASI_Mm02_00337034 predicted 256
11 SASI_Mm01_00027342 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031189
MYOG MISSION shRNA Bacterial Glycerol Stock
myogenin (myogenic factor 4)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031189.2-906s21c1
Sequence:CCGGGAATTTAGCTGACTCCTTAAACTCGAGTTTAAGGAGTCAGCTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-159s21c1
Sequence:CCGGAGCGGACTGAGCTCAGCTTAACTCGAGTTAAGCTGAGCTCAGTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-627s1c1
Sequence:CCGGCCCACAATCTGCACTCCCTTACTCGAGTAAGGGAGTGCAGATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-410s1c1
Sequence:CCGGCGCAGCGCCATCCAGTACATTCTCGAGAATGTACTGGATGGCGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-626s1c1
Sequence:CCGGGCCCACAATCTGCACTCCCTTCTCGAGAAGGGAGTGCAGATTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-694s1c1
Sequence:CCGGCCCAGACGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-671s21c1
Sequence:CCGGAGCATCACGGTGGAGGATATGCTCGAGCATATCCTCCACCGTGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031189.1-1100s1c1
Sequence:CCGGGCACATCTGTTCTAGTCTCTTCTCGAGAAGAGACTAGAACAGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031189
MYOG MISSION shRNA shRNA Plasmid DNA
myogenin (myogenic factor 4)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031189.2-906s21c1
Sequence:CCGGGAATTTAGCTGACTCCTTAAACTCGAGTTTAAGGAGTCAGCTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-159s21c1
Sequence:CCGGAGCGGACTGAGCTCAGCTTAACTCGAGTTAAGCTGAGCTCAGTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-627s1c1
Sequence:CCGGCCCACAATCTGCACTCCCTTACTCGAGTAAGGGAGTGCAGATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-410s1c1
Sequence:CCGGCGCAGCGCCATCCAGTACATTCTCGAGAATGTACTGGATGGCGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-626s1c1
Sequence:CCGGGCCCACAATCTGCACTCCCTTCTCGAGAAGGGAGTGCAGATTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-694s1c1
Sequence:CCGGCCCAGACGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-671s21c1
Sequence:CCGGAGCATCACGGTGGAGGATATGCTCGAGCATATCCTCCACCGTGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031189.1-1100s1c1
Sequence:CCGGGCACATCTGTTCTAGTCTCTTCTCGAGAAGAGACTAGAACAGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031189
MYOG MISSION shRNA Lentiviral Transduction Particles
myogenin (myogenic factor 4)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031189.2-906s21c1
Sequence:CCGGGAATTTAGCTGACTCCTTAAACTCGAGTTTAAGGAGTCAGCTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-159s21c1
Sequence:CCGGAGCGGACTGAGCTCAGCTTAACTCGAGTTAAGCTGAGCTCAGTCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-627s1c1
Sequence:CCGGCCCACAATCTGCACTCCCTTACTCGAGTAAGGGAGTGCAGATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-410s1c1
Sequence:CCGGCGCAGCGCCATCCAGTACATTCTCGAGAATGTACTGGATGGCGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-626s1c1
Sequence:CCGGGCCCACAATCTGCACTCCCTTCTCGAGAAGGGAGTGCAGATTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031189.1-694s1c1
Sequence:CCGGCCCAGACGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031189.2-671s21c1
Sequence:CCGGAGCATCACGGTGGAGGATATGCTCGAGCATATCCTCCACCGTGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031189.1-1100s1c1
Sequence:CCGGGCACATCTGTTCTAGTCTCTTCTCGAGAAGAGACTAGAACAGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002479
MYOG MISSION shRNA Bacterial Glycerol Stock
myogenin (myogenic factor 4)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1157s21c1
Sequence:CCGGCATTCAGCTGCCTCCTTAGAGCTCGAGCTCTAAGGAGGCAGCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002479.2-1164s1c1
Sequence:CCGGCCCTGAATTGAGAGAGAAGAACTCGAGTTCTTCTCTCTCAATTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-326s1c1
Sequence:CCGGCGCAGGCTCAAGAAGGTGAATCTCGAGATTCACCTTCTTGAGCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-259s1c1
Sequence:CCGGGTGTAAGGTGTGTAAGAGGAACTCGAGTTCCTCTTACACACCTTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-418s1c1
Sequence:CCGGGCGCAGTGCCATCCAGTACATCTCGAGATGTACTGGATGGCACTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-703s1c1
Sequence:CCGGCCCAGATGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1005s21c1
Sequence:CCGGTGGCCACAGATGCCACTACTTCTCGAGAAGTAGTGGCATCTGTGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002479.4-904s21c1
Sequence:CCGGGACAGCATCACAGTGGAAGATCTCGAGATCTTCCACTGTGATGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002479
MYOG MISSION shRNA shRNA Plasmid DNA
myogenin (myogenic factor 4)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1157s21c1
Sequence:CCGGCATTCAGCTGCCTCCTTAGAGCTCGAGCTCTAAGGAGGCAGCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002479.2-1164s1c1
Sequence:CCGGCCCTGAATTGAGAGAGAAGAACTCGAGTTCTTCTCTCTCAATTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-326s1c1
Sequence:CCGGCGCAGGCTCAAGAAGGTGAATCTCGAGATTCACCTTCTTGAGCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-259s1c1
Sequence:CCGGGTGTAAGGTGTGTAAGAGGAACTCGAGTTCCTCTTACACACCTTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-418s1c1
Sequence:CCGGGCGCAGTGCCATCCAGTACATCTCGAGATGTACTGGATGGCACTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-703s1c1
Sequence:CCGGCCCAGATGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1005s21c1
Sequence:CCGGTGGCCACAGATGCCACTACTTCTCGAGAAGTAGTGGCATCTGTGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002479.4-904s21c1
Sequence:CCGGGACAGCATCACAGTGGAAGATCTCGAGATCTTCCACTGTGATGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002479
MYOG MISSION shRNA Lentiviral Transduction Particles
myogenin (myogenic factor 4)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1157s21c1
Sequence:CCGGCATTCAGCTGCCTCCTTAGAGCTCGAGCTCTAAGGAGGCAGCTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002479.2-1164s1c1
Sequence:CCGGCCCTGAATTGAGAGAGAAGAACTCGAGTTCTTCTCTCTCAATTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-326s1c1
Sequence:CCGGCGCAGGCTCAAGAAGGTGAATCTCGAGATTCACCTTCTTGAGCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-259s1c1
Sequence:CCGGGTGTAAGGTGTGTAAGAGGAACTCGAGTTCCTCTTACACACCTTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-418s1c1
Sequence:CCGGGCGCAGTGCCATCCAGTACATCTCGAGATGTACTGGATGGCACTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002479.2-703s1c1
Sequence:CCGGCCCAGATGAAACCATGCCCAACTCGAGTTGGGCATGGTTTCATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002479.4-1005s21c1
Sequence:CCGGTGGCCACAGATGCCACTACTTCTCGAGAAGTAGTGGCATCTGTGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002479.4-904s21c1
Sequence:CCGGGACAGCATCACAGTGGAAGATCTCGAGATCTTCCACTGTGATGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)