EMAIL THIS PAGE TO A FRIEND

MYOM1

myomesin 1

119 Gene Product Result for
Synonyms: SKELEMIN
UniProtKB ID: P52179, Q14BD6, Q6H969, Q6ZUU0
Gene ID:
Human(8736) Summary: The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(17929) myomesin 1
Rat(316740) myomesin 1
chicken(395805) myomesin 1, 185kDa
cow(538404) myomesin 1, 185kDa
Horse(100062232) myomesin 1
dog(480191) myomesin 1
Domestic Rabbit(100347154) myomesin 1, 185kDa
sheep(101104877) myomesin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060661 MISSION® esiRNA esiRNA human MYOM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003803 Rosetta Predictions human pricing
NM_019856 Rosetta Predictions human pricing
XM_001054913 Rosetta Predictions rat pricing
XM_001054975 Rosetta Predictions rat pricing
XM_001055036 Rosetta Predictions rat pricing
XM_001055089 Rosetta Predictions rat pricing
XM_001065463 Rosetta Predictions rat pricing
XM_237523 Rosetta Predictions rat pricing
NM_001083934 Rosetta Predictions mouse pricing
NM_010867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229409 predicted 1591
2 SASI_Hs01_00229410 predicted 2013
3 SASI_Hs01_00229411 predicted 3747
4 SASI_Hs01_00229412 predicted 4230
5 SASI_Hs01_00229413 predicted 4806
6 SASI_Hs01_00229414 predicted 3594
7 SASI_Hs02_00336334 predicted 1056
8 SASI_Hs01_00229415 predicted 1587
9 SASI_Hs01_00229416 predicted 5250
10 SASI_Hs01_00229417 predicted 4616
11 SASI_Hs01_00229408 predicted 3150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352874 predicted 1594
2 SASI_Hs02_00352875 predicted 2016
3 SASI_Hs02_00352876 predicted 3459
4 SASI_Hs02_00352877 predicted 4519
5 SASI_Hs02_00352878 predicted 3305
6 SASI_Hs02_00352879 predicted 1050
7 SASI_Hs02_00352880 predicted 1591
8 SASI_Hs02_00352881 predicted 4969
9 SASI_Hs02_00352882 predicted 4328
10 SASI_Hs02_00352883 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277692 predicted 4045
2 SASI_Rn02_00277693 predicted 666
3 SASI_Rn02_00277694 predicted 1414
4 SASI_Rn02_00277695 predicted 4614
5 SASI_Rn02_00277696 predicted 3608
6 SASI_Rn02_00277697 predicted 1635
7 SASI_Rn02_00277698 predicted 2327
8 SASI_Rn02_00277699 predicted 922
9 SASI_Rn02_00277700 predicted 3555
10 SASI_Rn02_00277701 predicted 2790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277902 predicted 4106
2 SASI_Rn02_00277903 predicted 727
3 SASI_Rn02_00277904 predicted 1478
4 SASI_Rn02_00277905 predicted 4676
5 SASI_Rn02_00277906 predicted 3668
6 SASI_Rn02_00277907 predicted 1687
7 SASI_Rn02_00277908 predicted 2390
8 SASI_Rn02_00277909 predicted 985
9 SASI_Rn02_00277910 predicted 3610
10 SASI_Rn02_00277911 predicted 2853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278172 predicted 3764
2 SASI_Rn02_00278173 predicted 680
3 SASI_Rn02_00278174 predicted 1431
4 SASI_Rn02_00278175 predicted 4335
5 SASI_Rn02_00278176 predicted 3320
6 SASI_Rn02_00278177 predicted 1645
7 SASI_Rn02_00278178 predicted 2334
8 SASI_Rn02_00278179 predicted 934
9 SASI_Rn02_00278180 predicted 3268
10 SASI_Rn02_00278181 predicted 2508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278415 predicted 4190
2 SASI_Rn02_00278416 predicted 804
3 SASI_Rn02_00278417 predicted 1557
4 SASI_Rn02_00278418 predicted 4757
5 SASI_Rn02_00278419 predicted 3748
6 SASI_Rn02_00278420 predicted 1770
7 SASI_Rn02_00278421 predicted 2464
8 SASI_Rn02_00278422 predicted 1057
9 SASI_Rn02_00278423 predicted 3696
10 SASI_Rn02_00278424 predicted 2929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314239 predicted 3764
2 SASI_Rn02_00314240 predicted 677
3 SASI_Rn02_00314241 predicted 1428
4 SASI_Rn02_00314242 predicted 4329
5 SASI_Rn02_00314243 predicted 3321
6 SASI_Rn02_00314244 predicted 1645
7 SASI_Rn02_00314245 predicted 2338
8 SASI_Rn02_00314246 predicted 932
9 SASI_Rn02_00314247 predicted 3268
10 SASI_Rn02_00314248 predicted 2509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390979 predicted 4047
2 SASI_Rn02_00390980 predicted 666
3 SASI_Rn02_00390981 predicted 1414
4 SASI_Rn02_00390982 predicted 4610
5 SASI_Rn02_00390983 predicted 3608
6 SASI_Rn02_00390984 predicted 1629
7 SASI_Rn02_00390985 predicted 2326
8 SASI_Rn02_00390986 predicted 918
9 SASI_Rn02_00390987 predicted 3555
10 SASI_Rn02_00390988 predicted 2785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300076 predicted 2796
2 SASI_Mm02_00300077 predicted 3375
3 SASI_Mm02_00300078 predicted 4121
4 SASI_Mm02_00300079 predicted 784
5 SASI_Mm02_00300080 predicted 3428
6 SASI_Mm02_00300081 predicted 1749
7 SASI_Mm02_00300082 predicted 1535
8 SASI_Mm02_00300083 predicted 1714
9 SASI_Mm02_00300084 predicted 4054
10 SASI_Mm02_00300085 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319542 predicted 3089
2 SASI_Mm01_00052234 predicted 3672
3 SASI_Mm02_00319543 predicted 4412
4 SASI_Mm01_00052235 predicted 779
5 SASI_Mm01_00052236 predicted 3725
6 SASI_Mm02_00319544 predicted 1752
7 SASI_Mm01_00052237 predicted 1528
8 SASI_Mm01_00052238 predicted 1719
9 SASI_Mm01_00052239 predicted 4348
10 SASI_Mm01_00052241 predicted 1009
11 SASI_Mm01_00052232 predicted 1558
12 SASI_Mm01_00052233 predicted 1291
13 SASI_Mm01_00052240 predicted 1529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003803
MYOM1 MISSION shRNA Bacterial Glycerol Stock
myomesin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4379s1c1
Sequence:CCGGCGGCAAGAATGGATCAGGAAACTCGAGTTTCCTGATCCATTCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4900s1c1
Sequence:CCGGCCCGAATGACAAAGGGAAGTACTCGAGTACTTCCCTTTGTCATTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2066s1c1
Sequence:CCGGCGTTCCTATATCTTCCGAGTTCTCGAGAACTCGGAAGATATAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-3221s1c1
Sequence:CCGGGCAGAAATTACTGGCTATTATCTCGAGATAATAGCCAGTAATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5513s1c1
Sequence:CCGGGTCAGGTCTTTCACTCATATACTCGAGTATATGAGTGAAAGACCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5601s1c1
Sequence:CCGGCCATTCATAGCATGAAGATTACTCGAGTAATCTTCATGCTATGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2154s1c1
Sequence:CCGGCGGCTGAGAAAGCTAGACTTACTCGAGTAAGTCTAGCTTTCTCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-1948s21c1
Sequence:CCGGGAGTCCTATTCTCGGATATTTCTCGAGAAATATCCGAGAATAGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-3602s21c1
Sequence:CCGGCTCAATGAGGCGGCTATTAAACTCGAGTTTAATAGCCGCCTCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003803
MYOM1 MISSION shRNA shRNA Plasmid DNA
myomesin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4379s1c1
Sequence:CCGGCGGCAAGAATGGATCAGGAAACTCGAGTTTCCTGATCCATTCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4900s1c1
Sequence:CCGGCCCGAATGACAAAGGGAAGTACTCGAGTACTTCCCTTTGTCATTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2066s1c1
Sequence:CCGGCGTTCCTATATCTTCCGAGTTCTCGAGAACTCGGAAGATATAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-3221s1c1
Sequence:CCGGGCAGAAATTACTGGCTATTATCTCGAGATAATAGCCAGTAATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5513s1c1
Sequence:CCGGGTCAGGTCTTTCACTCATATACTCGAGTATATGAGTGAAAGACCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5601s1c1
Sequence:CCGGCCATTCATAGCATGAAGATTACTCGAGTAATCTTCATGCTATGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2154s1c1
Sequence:CCGGCGGCTGAGAAAGCTAGACTTACTCGAGTAAGTCTAGCTTTCTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-1948s21c1
Sequence:CCGGGAGTCCTATTCTCGGATATTTCTCGAGAAATATCCGAGAATAGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-3602s21c1
Sequence:CCGGCTCAATGAGGCGGCTATTAAACTCGAGTTTAATAGCCGCCTCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003803
MYOM1 MISSION shRNA Lentiviral Transduction Particles
myomesin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4379s1c1
Sequence:CCGGCGGCAAGAATGGATCAGGAAACTCGAGTTTCCTGATCCATTCTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-4900s1c1
Sequence:CCGGCCCGAATGACAAAGGGAAGTACTCGAGTACTTCCCTTTGTCATTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2066s1c1
Sequence:CCGGCGTTCCTATATCTTCCGAGTTCTCGAGAACTCGGAAGATATAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-3221s1c1
Sequence:CCGGGCAGAAATTACTGGCTATTATCTCGAGATAATAGCCAGTAATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5513s1c1
Sequence:CCGGGTCAGGTCTTTCACTCATATACTCGAGTATATGAGTGAAAGACCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003803.2-5601s1c1
Sequence:CCGGCCATTCATAGCATGAAGATTACTCGAGTAATCTTCATGCTATGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003803.2-2154s1c1
Sequence:CCGGCGGCTGAGAAAGCTAGACTTACTCGAGTAAGTCTAGCTTTCTCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-1948s21c1
Sequence:CCGGGAGTCCTATTCTCGGATATTTCTCGAGAAATATCCGAGAATAGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003803.3-3602s21c1
Sequence:CCGGCTCAATGAGGCGGCTATTAAACTCGAGTTTAATAGCCGCCTCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010867
MYOM1 MISSION shRNA Bacterial Glycerol Stock
myomesin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-3962s1c1
Sequence:CCGGGCCGAAATACAAGATGCACATCTCGAGATGTGCATCTTGTATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-4171s1c1
Sequence:CCGGGCCCACATTTCGCTGAGTATTCTCGAGAATACTCAGCGAAATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1065s1c1
Sequence:CCGGCCGGGAAAGTACATCATTGAACTCGAGTTCAATGATGTACTTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1782s1c1
Sequence:CCGGCCTGTGAAGTTTGCTCGGTTTCTCGAGAAACCGAGCAAACTTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010867
MYOM1 MISSION shRNA shRNA Plasmid DNA
myomesin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-3962s1c1
Sequence:CCGGGCCGAAATACAAGATGCACATCTCGAGATGTGCATCTTGTATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-4171s1c1
Sequence:CCGGGCCCACATTTCGCTGAGTATTCTCGAGAATACTCAGCGAAATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1065s1c1
Sequence:CCGGCCGGGAAAGTACATCATTGAACTCGAGTTCAATGATGTACTTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1782s1c1
Sequence:CCGGCCTGTGAAGTTTGCTCGGTTTCTCGAGAAACCGAGCAAACTTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010867
MYOM1 MISSION shRNA Lentiviral Transduction Particles
myomesin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-3962s1c1
Sequence:CCGGGCCGAAATACAAGATGCACATCTCGAGATGTGCATCTTGTATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-4171s1c1
Sequence:CCGGGCCCACATTTCGCTGAGTATTCTCGAGAATACTCAGCGAAATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1065s1c1
Sequence:CCGGCCGGGAAAGTACATCATTGAACTCGAGTTCAATGATGTACTTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010867.1-1782s1c1
Sequence:CCGGCCTGTGAAGTTTGCTCGGTTTCTCGAGAAACCGAGCAAACTTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)