EMAIL THIS PAGE TO A FRIEND

MYOM2

myomesin 2

60 Gene Product Result for
Synonyms: TTNAP
UniProtKB ID: P54296, Q7Z3Y2
Gene ID:
Human(9172) Summary: The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Mouse(17930) myomesin 2
Rat(306616) myomesin 2
Zebrafish(100538326) myomesin (M-protein) 2, 165kDa
cow(524077) myomesin (M-protein) 2, 165kDa
Horse(100065193) myomesin 2
dog(491446) myomesin (M-protein) 2, 165kDa
chicken(396034) myomesin (M-protein) 2, 165kDa
sheep(101102872) myomesin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003970 Rosetta Predictions human pricing
XM_001074764 Rosetta Predictions rat pricing
XM_240481 Rosetta Predictions rat pricing
NM_008664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123459 predicted 3063
2 SASI_Hs01_00123461 predicted 3700
3 SASI_Hs01_00123462 predicted 1394
4 SASI_Hs01_00123463 predicted 3718
5 SASI_Hs01_00123464 predicted 775
6 SASI_Hs01_00123465 predicted 2369
7 SASI_Hs02_00336651 predicted 3277
8 SASI_Hs01_00123466 predicted 565
9 SASI_Hs01_00123467 predicted 3369
10 SASI_Hs02_00336652 predicted 2726
11 SASI_Hs01_00123460 predicted 3244
12 SASI_Hs01_00123468 predicted 2653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347292 predicted 3147
2 SASI_Rn02_00347293 predicted 3298
3 SASI_Rn02_00347294 predicted 1609
4 SASI_Rn02_00347295 predicted 996
5 SASI_Rn02_00347296 predicted 2152
6 SASI_Rn02_00347297 predicted 3326
7 SASI_Rn02_00347298 predicted 2881
8 SASI_Rn02_00347299 predicted 2260
9 SASI_Rn02_00347300 predicted 783
10 SASI_Rn02_00347301 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391609 predicted 3480
2 SASI_Rn02_00391610 predicted 3343
3 SASI_Rn02_00391611 predicted 1423
4 SASI_Rn02_00391612 predicted 1488
5 SASI_Rn02_00391613 predicted 1611
6 SASI_Rn02_00391614 predicted 1002
7 SASI_Rn02_00391615 predicted 3327
8 SASI_Rn02_00391616 predicted 1594
9 SASI_Rn02_00391617 predicted 786
10 SASI_Rn02_00391618 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314418 predicted 2094
2 SASI_Mm01_00106542 predicted 739
3 SASI_Mm02_00314419 predicted 1384
4 SASI_Mm01_00106544 predicted 1447
5 SASI_Mm02_00314420 predicted 1543
6 SASI_Mm01_00106543 predicted 4474
7 SASI_Mm01_00106545 predicted 519
8 SASI_Mm01_00106546 predicted 4331
9 SASI_Mm01_00106548 predicted 992
10 SASI_Mm01_00106547 predicted 2861
11 SASI_Mm01_00106549 predicted 3324
12 SASI_Mm01_00106550 predicted 2246
13 SASI_Mm01_00106551 predicted 3311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003970
MYOM2 MISSION shRNA Bacterial Glycerol Stock
myomesin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-3313s21c1
Sequence:CCGGAGCGAGATACACAGAATTAAACTCGAGTTTAATTCTGTGTATCTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003970.2-4733s21c1
Sequence:CCGGCAAGACTGAACAACGTGTATTCTCGAGAATACACGTTGTTCAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-2733s21c1
Sequence:CCGGGACAACAGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4552s1c1
Sequence:CCGGGCTGATAGTTGATCACACATTCTCGAGAATGTGTGATCAACTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003970.1-4170s1c1
Sequence:CCGGCGAAGTGATTTGGTTCAAGAACTCGAGTTCTTGAACCAAATCACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4617s1c1
Sequence:CCGGCTAAGGGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4706s1c1
Sequence:CCGGGCAGACAACACACTAGCATTTCTCGAGAAATGCTAGTGTGTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003970
MYOM2 MISSION shRNA shRNA Plasmid DNA
myomesin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-3313s21c1
Sequence:CCGGAGCGAGATACACAGAATTAAACTCGAGTTTAATTCTGTGTATCTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003970.2-4733s21c1
Sequence:CCGGCAAGACTGAACAACGTGTATTCTCGAGAATACACGTTGTTCAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-2733s21c1
Sequence:CCGGGACAACAGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4552s1c1
Sequence:CCGGGCTGATAGTTGATCACACATTCTCGAGAATGTGTGATCAACTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003970.1-4170s1c1
Sequence:CCGGCGAAGTGATTTGGTTCAAGAACTCGAGTTCTTGAACCAAATCACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4617s1c1
Sequence:CCGGCTAAGGGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4706s1c1
Sequence:CCGGGCAGACAACACACTAGCATTTCTCGAGAAATGCTAGTGTGTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003970
MYOM2 MISSION shRNA Lentiviral Transduction Particles
myomesin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-3313s21c1
Sequence:CCGGAGCGAGATACACAGAATTAAACTCGAGTTTAATTCTGTGTATCTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003970.2-4733s21c1
Sequence:CCGGCAAGACTGAACAACGTGTATTCTCGAGAATACACGTTGTTCAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003970.2-2733s21c1
Sequence:CCGGGACAACAGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4552s1c1
Sequence:CCGGGCTGATAGTTGATCACACATTCTCGAGAATGTGTGATCAACTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003970.1-4170s1c1
Sequence:CCGGCGAAGTGATTTGGTTCAAGAACTCGAGTTCTTGAACCAAATCACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4617s1c1
Sequence:CCGGCTAAGGGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003970.1-4706s1c1
Sequence:CCGGGCAGACAACACACTAGCATTTCTCGAGAAATGCTAGTGTGTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008664
MYOM2 MISSION shRNA Bacterial Glycerol Stock
myomesin 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-1335s1c1
Sequence:CCGGCCTGTCATTGGCTACTTCATTCTCGAGAATGAAGTAGCCAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2732s1c1
Sequence:CCGGGCAGGGTAAGACCTATGTATTCTCGAGAATACATAGGTCTTACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-772s1c1
Sequence:CCGGCCACCTATTCAGCAGTAGCAACTCGAGTTGCTACTGCTGAATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2085s1c1
Sequence:CCGGCCCATTGGATATAACAGGTTTCTCGAGAAACCTGTTATATCCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008664
MYOM2 MISSION shRNA shRNA Plasmid DNA
myomesin 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-1335s1c1
Sequence:CCGGCCTGTCATTGGCTACTTCATTCTCGAGAATGAAGTAGCCAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2732s1c1
Sequence:CCGGGCAGGGTAAGACCTATGTATTCTCGAGAATACATAGGTCTTACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-772s1c1
Sequence:CCGGCCACCTATTCAGCAGTAGCAACTCGAGTTGCTACTGCTGAATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2085s1c1
Sequence:CCGGCCCATTGGATATAACAGGTTTCTCGAGAAACCTGTTATATCCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008664
MYOM2 MISSION shRNA Lentiviral Transduction Particles
myomesin 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-1335s1c1
Sequence:CCGGCCTGTCATTGGCTACTTCATTCTCGAGAATGAAGTAGCCAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2732s1c1
Sequence:CCGGGCAGGGTAAGACCTATGTATTCTCGAGAATACATAGGTCTTACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-772s1c1
Sequence:CCGGCCACCTATTCAGCAGTAGCAACTCGAGTTGCTACTGCTGAATAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008664.1-2085s1c1
Sequence:CCGGCCCATTGGATATAACAGGTTTCTCGAGAAACCTGTTATATCCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)