EMAIL THIS PAGE TO A FRIEND

MYOT

myotilin

66 Gene Product Result for
Synonyms: LGMD1 LGMD1A MFM3 TTID TTOD
UniProtKB ID: Q9UBF9, A0A4R6, B4DT79
Gene ID:
Human(9499) Summary: This gene encodes a cystoskeletal protein which plays a significant role in the stability of thin filaments during muscle contraction. This protein binds F-actin, crosslinks actin filaments, and prevents latrunculin A-induced filament disassembly. Mutations in this gene have been associated with limb-girdle muscular dystrophy and myofibrillar myopathies. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.[provided by RefSeq, Oct 2008]
Mouse(58916) myotilin
Rat(291605) myotilin
chicken(416299) myotilin
dog(610400) myotilin
cow(507884) myotilin
Horse(100072634) myotilin
sheep(101107350) myotilin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006790 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006790 Rosetta Predictions human pricing
NM_001106148 Rosetta Predictions rat pricing
NM_001033621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183131 predicted 1653
2 SASI_Hs01_00183132 predicted 1038
3 SASI_Hs01_00183133 predicted 407
4 SASI_Hs01_00183134 predicted 802
5 SASI_Hs02_00342309 predicted 1330
6 SASI_Hs01_00183135 predicted 1365
7 SASI_Hs01_00183136 predicted 1235
8 SASI_Hs01_00183137 predicted 1629
9 SASI_Hs01_00183138 predicted 354
10 SASI_Hs01_00183139 predicted 769
11 SASI_Hs01_00183130 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216098 predicted 1433
2 SASI_Rn02_00216099 predicted 572
3 SASI_Rn02_00216100 predicted 839
4 SASI_Rn02_00216101 predicted 1349
5 SASI_Rn02_00216102 predicted 1456
6 SASI_Rn02_00216103 predicted 1132
7 SASI_Rn02_00216104 predicted 732
8 SASI_Rn02_00216105 predicted 1411
9 SASI_Rn02_00216106 predicted 757
10 SASI_Rn02_00216107 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144324 predicted 1435
2 SASI_Mm01_00144325 predicted 1102
3 SASI_Mm02_00288936 predicted 974
4 SASI_Mm01_00144326 predicted 1158
5 SASI_Mm01_00144327 predicted 764
6 SASI_Mm01_00144328 predicted 886
7 SASI_Mm01_00144329 predicted 297
8 SASI_Mm01_00144331 predicted 1135
9 SASI_Mm02_00288937 predicted 1433
10 SASI_Mm02_00288938 predicted 764
11 SASI_Mm01_00144330 predicted 852
12 SASI_Mm01_00144332 predicted 1418
13 SASI_Mm01_00144333 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006790
MYOT MISSION shRNA Bacterial Glycerol Stock
myotilin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1146s21c1
Sequence:CCGGTGATGTGTCATGGTATCTAAACTCGAGTTTAGATACCATGACACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1669s21c1
Sequence:CCGGTTACGGGTTCGACCAACATTCCTCGAGGAATGTTGGTCGAACCCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-832s21c1
Sequence:CCGGGGAAATCAACGTCTAACATATCTCGAGATATGTTAGACGTTGATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-592s21c1
Sequence:CCGGAGCTTCCTCAGCTCCATATTACTCGAGTAATATGGAGCTGAGGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1322s1c1
Sequence:CCGGGCACCAATGTTTATCTACAAACTCGAGTTTGTAGATAAACATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-593s1c1
Sequence:CCGGCCTGATTACAATAGCAGTAAACTCGAGTTTACTGCTATTGTAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-954s1c1
Sequence:CCGGCACAAGTAAGAAGTAGATCAACTCGAGTTGATCTACTTCTTACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006790.1-1966s1c1
Sequence:CCGGGCCTACAGGAAATCTGGGTATCTCGAGATACCCAGATTTCCTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1604s1c1
Sequence:CCGGGCACGTCCAAACCAAACTCTTCTCGAGAAGAGTTTGGTTTGGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006790
MYOT MISSION shRNA shRNA Plasmid DNA
myotilin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1146s21c1
Sequence:CCGGTGATGTGTCATGGTATCTAAACTCGAGTTTAGATACCATGACACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1669s21c1
Sequence:CCGGTTACGGGTTCGACCAACATTCCTCGAGGAATGTTGGTCGAACCCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-832s21c1
Sequence:CCGGGGAAATCAACGTCTAACATATCTCGAGATATGTTAGACGTTGATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-592s21c1
Sequence:CCGGAGCTTCCTCAGCTCCATATTACTCGAGTAATATGGAGCTGAGGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1322s1c1
Sequence:CCGGGCACCAATGTTTATCTACAAACTCGAGTTTGTAGATAAACATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-593s1c1
Sequence:CCGGCCTGATTACAATAGCAGTAAACTCGAGTTTACTGCTATTGTAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-954s1c1
Sequence:CCGGCACAAGTAAGAAGTAGATCAACTCGAGTTGATCTACTTCTTACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006790.1-1966s1c1
Sequence:CCGGGCCTACAGGAAATCTGGGTATCTCGAGATACCCAGATTTCCTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1604s1c1
Sequence:CCGGGCACGTCCAAACCAAACTCTTCTCGAGAAGAGTTTGGTTTGGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006790
MYOT MISSION shRNA Lentiviral Transduction Particles
myotilin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1146s21c1
Sequence:CCGGTGATGTGTCATGGTATCTAAACTCGAGTTTAGATACCATGACACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-1669s21c1
Sequence:CCGGTTACGGGTTCGACCAACATTCCTCGAGGAATGTTGGTCGAACCCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-832s21c1
Sequence:CCGGGGAAATCAACGTCTAACATATCTCGAGATATGTTAGACGTTGATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006790.2-592s21c1
Sequence:CCGGAGCTTCCTCAGCTCCATATTACTCGAGTAATATGGAGCTGAGGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1322s1c1
Sequence:CCGGGCACCAATGTTTATCTACAAACTCGAGTTTGTAGATAAACATTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-593s1c1
Sequence:CCGGCCTGATTACAATAGCAGTAAACTCGAGTTTACTGCTATTGTAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-954s1c1
Sequence:CCGGCACAAGTAAGAAGTAGATCAACTCGAGTTGATCTACTTCTTACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006790.1-1966s1c1
Sequence:CCGGGCCTACAGGAAATCTGGGTATCTCGAGATACCCAGATTTCCTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006790.1-1604s1c1
Sequence:CCGGGCACGTCCAAACCAAACTCTTCTCGAGAAGAGTTTGGTTTGGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021484
MYOT MISSION shRNA Bacterial Glycerol Stock
myotilin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021484.2-1949s1c1
Sequence:CCGGGCCAACAGTAAACTAAGTATACTCGAGTATACTTAGTTTACTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1019s1c1
Sequence:CCGGGCTTCATTCAAGTGCCAGAAACTCGAGTTTCTGGCACTTGAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1309s1c1
Sequence:CCGGGCACCGATGTTTATCTTCAAACTCGAGTTTGAAGATAAACATCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-583s1c1
Sequence:CCGGCCCGATTACTGTAACAGTAAACTCGAGTTTACTGTTACAGTAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-736s1c1
Sequence:CCGGGCGTTGATTCAAGATTTGGAACTCGAGTTCCAAATCTTGAATCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021484
MYOT MISSION shRNA shRNA Plasmid DNA
myotilin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021484.2-1949s1c1
Sequence:CCGGGCCAACAGTAAACTAAGTATACTCGAGTATACTTAGTTTACTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1019s1c1
Sequence:CCGGGCTTCATTCAAGTGCCAGAAACTCGAGTTTCTGGCACTTGAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1309s1c1
Sequence:CCGGGCACCGATGTTTATCTTCAAACTCGAGTTTGAAGATAAACATCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-583s1c1
Sequence:CCGGCCCGATTACTGTAACAGTAAACTCGAGTTTACTGTTACAGTAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-736s1c1
Sequence:CCGGGCGTTGATTCAAGATTTGGAACTCGAGTTCCAAATCTTGAATCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021484
MYOT MISSION shRNA Lentiviral Transduction Particles
myotilin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021484.2-1949s1c1
Sequence:CCGGGCCAACAGTAAACTAAGTATACTCGAGTATACTTAGTTTACTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1019s1c1
Sequence:CCGGGCTTCATTCAAGTGCCAGAAACTCGAGTTTCTGGCACTTGAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-1309s1c1
Sequence:CCGGGCACCGATGTTTATCTTCAAACTCGAGTTTGAAGATAAACATCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-583s1c1
Sequence:CCGGCCCGATTACTGTAACAGTAAACTCGAGTTTACTGTTACAGTAATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021484.2-736s1c1
Sequence:CCGGGCGTTGATTCAAGATTTGGAACTCGAGTTCCAAATCTTGAATCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)