EMAIL THIS PAGE TO A FRIEND

MYOZ1

myozenin 1

62 Gene Product Result for
Synonyms: CS-2 FATZ MYOZ
UniProtKB ID: Q9NP98, Q9H1I7
Gene ID:
Human(58529) Summary: The protein encoded by this gene is primarily expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]
Mouse(59011) myozenin 1
Rat(498440) myozenin 1
sheep(101119610) myozenin 1
chicken(423744) myozenin 1
dog(479250) myozenin 1
cow(281939) myozenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021245 Rosetta Predictions human pricing
NM_001109097 Rosetta Predictions rat pricing
NM_021508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203777 predicted 423
2 SASI_Hs01_00203778 predicted 895
3 SASI_Hs02_00354905 predicted 1076
4 SASI_Hs02_00354906 predicted 1073
5 SASI_Hs01_00203779 predicted 996
6 SASI_Hs01_00203780 predicted 731
7 SASI_Hs01_00203781 predicted 407
8 SASI_Hs01_00203782 predicted 963
9 SASI_Hs01_00203783 predicted 1273
10 SASI_Hs01_00203784 predicted 1143
11 SASI_Hs01_00203775 predicted 1256
12 SASI_Hs01_00203776 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245100 predicted 955
2 SASI_Rn02_00245101 predicted 600
3 SASI_Rn02_00245102 predicted 678
4 SASI_Rn02_00245103 predicted 606
5 SASI_Rn02_00245104 predicted 279
6 SASI_Rn02_00245105 predicted 788
7 SASI_Rn02_00245106 predicted 593
8 SASI_Rn02_00245107 predicted 593
9 SASI_Rn02_00245108 predicted 326
10 SASI_Rn02_00245109 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157201 predicted 737
2 SASI_Mm01_00157202 predicted 498
3 SASI_Mm01_00157203 predicted 1025
4 SASI_Mm01_00157204 predicted 651
5 SASI_Mm01_00157205 predicted 773
6 SASI_Mm01_00157206 predicted 715
7 SASI_Mm01_00157207 predicted 894
8 SASI_Mm01_00157208 predicted 240
9 SASI_Mm01_00157209 predicted 591
10 SASI_Mm01_00157210 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021508
MYOZ1 MISSION shRNA Bacterial Glycerol Stock
myozenin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021508.2-1148s1c1
Sequence:CCGGCCCAACTGTTAATCCAGTATTCTCGAGAATACTGGATTAACAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-379s1c1
Sequence:CCGGCGGGTGGAGAAATTTATCTATCTCGAGATAGATAAATTTCTCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-831s1c1
Sequence:CCGGGTCCTTCAACAGGACAGCAATCTCGAGATTGCTGTCCTGTTGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-705s1c1
Sequence:CCGGTGTCACTGTGTTCAAGACTTACTCGAGTAAGTCTTGAACACAGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-1018s1c1
Sequence:CCGGGTAGACTACAACGTGGATGTTCTCGAGAACATCCACGTTGTAGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021508
MYOZ1 MISSION shRNA shRNA Plasmid DNA
myozenin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021508.2-1148s1c1
Sequence:CCGGCCCAACTGTTAATCCAGTATTCTCGAGAATACTGGATTAACAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-379s1c1
Sequence:CCGGCGGGTGGAGAAATTTATCTATCTCGAGATAGATAAATTTCTCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-831s1c1
Sequence:CCGGGTCCTTCAACAGGACAGCAATCTCGAGATTGCTGTCCTGTTGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-705s1c1
Sequence:CCGGTGTCACTGTGTTCAAGACTTACTCGAGTAAGTCTTGAACACAGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-1018s1c1
Sequence:CCGGGTAGACTACAACGTGGATGTTCTCGAGAACATCCACGTTGTAGTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021508
MYOZ1 MISSION shRNA Lentiviral Transduction Particles
myozenin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021508.2-1148s1c1
Sequence:CCGGCCCAACTGTTAATCCAGTATTCTCGAGAATACTGGATTAACAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-379s1c1
Sequence:CCGGCGGGTGGAGAAATTTATCTATCTCGAGATAGATAAATTTCTCCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-831s1c1
Sequence:CCGGGTCCTTCAACAGGACAGCAATCTCGAGATTGCTGTCCTGTTGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-705s1c1
Sequence:CCGGTGTCACTGTGTTCAAGACTTACTCGAGTAAGTCTTGAACACAGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021508.2-1018s1c1
Sequence:CCGGGTAGACTACAACGTGGATGTTCTCGAGAACATCCACGTTGTAGTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021245
MYOZ1 MISSION shRNA Bacterial Glycerol Stock
myozenin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1038s1c1
Sequence:CCGGGCAATGCCCTATGGTGGATATCTCGAGATATCCACCATAGGGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-539s1c1
Sequence:CCGGGATGTTCAAACTGCGGCAGATCTCGAGATCTGCCGCAGTTTGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021245.2-1505s1c1
Sequence:CCGGCCACCAGTAACAGTCAATAAACTCGAGTTTATTGACTGTTACTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-610s1c1
Sequence:CCGGGCTCAATGGATCACTTCCAGACTCGAGTCTGGAAGTGATCCATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021245.2-1274s21c1
Sequence:CCGGCTCCTCTGATTTGCATCATTTCTCGAGAAATGATGCAAATCAGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021245.2-1210s21c1
Sequence:CCGGTAGACTACAACGTGGATATTGCTCGAGCAATATCCACGTTGTAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1070s1c1
Sequence:CCGGCAAACGCATGACCTTCCAGATCTCGAGATCTGGAAGGTCATGCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-626s1c1
Sequence:CCGGCCAGAAGTTCCTTCCAACAGTCTCGAGACTGTTGGAAGGAACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-611s1c1
Sequence:CCGGCTCAATGGATCACTTCCAGAACTCGAGTTCTGGAAGTGATCCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-401s1c1
Sequence:CCGGGAGGAAATCCAGCAAGCTGATCTCGAGATCAGCTTGCTGGATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021245
MYOZ1 MISSION shRNA shRNA Plasmid DNA
myozenin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1038s1c1
Sequence:CCGGGCAATGCCCTATGGTGGATATCTCGAGATATCCACCATAGGGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-539s1c1
Sequence:CCGGGATGTTCAAACTGCGGCAGATCTCGAGATCTGCCGCAGTTTGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021245.2-1505s1c1
Sequence:CCGGCCACCAGTAACAGTCAATAAACTCGAGTTTATTGACTGTTACTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-610s1c1
Sequence:CCGGGCTCAATGGATCACTTCCAGACTCGAGTCTGGAAGTGATCCATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021245.2-1274s21c1
Sequence:CCGGCTCCTCTGATTTGCATCATTTCTCGAGAAATGATGCAAATCAGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021245.2-1210s21c1
Sequence:CCGGTAGACTACAACGTGGATATTGCTCGAGCAATATCCACGTTGTAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1070s1c1
Sequence:CCGGCAAACGCATGACCTTCCAGATCTCGAGATCTGGAAGGTCATGCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-626s1c1
Sequence:CCGGCCAGAAGTTCCTTCCAACAGTCTCGAGACTGTTGGAAGGAACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-611s1c1
Sequence:CCGGCTCAATGGATCACTTCCAGAACTCGAGTTCTGGAAGTGATCCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-401s1c1
Sequence:CCGGGAGGAAATCCAGCAAGCTGATCTCGAGATCAGCTTGCTGGATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021245
MYOZ1 MISSION shRNA Lentiviral Transduction Particles
myozenin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1038s1c1
Sequence:CCGGGCAATGCCCTATGGTGGATATCTCGAGATATCCACCATAGGGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-539s1c1
Sequence:CCGGGATGTTCAAACTGCGGCAGATCTCGAGATCTGCCGCAGTTTGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021245.2-1505s1c1
Sequence:CCGGCCACCAGTAACAGTCAATAAACTCGAGTTTATTGACTGTTACTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-610s1c1
Sequence:CCGGGCTCAATGGATCACTTCCAGACTCGAGTCTGGAAGTGATCCATTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021245.2-1274s21c1
Sequence:CCGGCTCCTCTGATTTGCATCATTTCTCGAGAAATGATGCAAATCAGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021245.2-1210s21c1
Sequence:CCGGTAGACTACAACGTGGATATTGCTCGAGCAATATCCACGTTGTAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-1070s1c1
Sequence:CCGGCAAACGCATGACCTTCCAGATCTCGAGATCTGGAAGGTCATGCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-626s1c1
Sequence:CCGGCCAGAAGTTCCTTCCAACAGTCTCGAGACTGTTGGAAGGAACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-611s1c1
Sequence:CCGGCTCAATGGATCACTTCCAGAACTCGAGTTCTGGAAGTGATCCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021245.2-401s1c1
Sequence:CCGGGAGGAAATCCAGCAAGCTGATCTCGAGATCAGCTTGCTGGATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)