EMAIL THIS PAGE TO A FRIEND

MYOZ2

myozenin 2

65 Gene Product Result for
Synonyms: C4orf5 CMH16 CS-1
UniProtKB ID: Q9NPC6, O43415, Q9HB92
Gene ID:
Human(51778) Summary: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. [provided by RefSeq, Aug 2011]
Mouse(59006) myozenin 2
Rat(295426) myozenin 2
chicken(422682) myozenin 2
cow(540487) myozenin 2
dog(478524) myozenin 2
sheep(100526817) myozenin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143811 MISSION® esiRNA esiRNA human MYOZ2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016599 Rosetta Predictions human pricing
NM_001106469 Rosetta Predictions rat pricing
NM_021503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072093 predicted 379
2 SASI_Hs01_00072094 predicted 1108
3 SASI_Hs01_00072096 predicted 1101
4 SASI_Hs01_00072097 predicted 808
5 SASI_Hs01_00072098 predicted 929
6 SASI_Hs01_00072099 predicted 930
7 SASI_Hs02_00349728 predicted 222
8 SASI_Hs01_00072100 predicted 392
9 SASI_Hs01_00072101 predicted 978
10 SASI_Hs01_00072102 predicted 950
11 SASI_Hs01_00072095 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219268 predicted 687
2 SASI_Rn02_00219269 predicted 458
3 SASI_Rn02_00219270 predicted 338
4 SASI_Rn02_00219271 predicted 373
5 SASI_Rn02_00219272 predicted 691
6 SASI_Rn02_00219273 predicted 510
7 SASI_Rn02_00219274 predicted 285
8 SASI_Rn02_00219275 predicted 608
9 SASI_Rn02_00219276 predicted 527
10 SASI_Rn02_00219277 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058053 predicted 207
2 SASI_Mm01_00058054 predicted 318
3 SASI_Mm01_00058055 predicted 193
4 SASI_Mm01_00058056 predicted 501
5 SASI_Mm01_00058057 predicted 303
6 SASI_Mm01_00058058 predicted 272
7 SASI_Mm01_00058059 predicted 517
8 SASI_Mm02_00326215 predicted 880
9 SASI_Mm01_00058060 predicted 322
10 SASI_Mm01_00058062 predicted 545
11 SASI_Mm01_00058061 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016599
MYOZ2 MISSION shRNA Bacterial Glycerol Stock
myozenin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016599.3-750s21c1
Sequence:CCGGGCCTGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-294s1c1
Sequence:CCGGGCCAGGCTATTTAAGATGCGTCTCGAGACGCATCTTAAATAGCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-1156s1c1
Sequence:CCGGCCTGGTTTAAAGAATCCAGATCTCGAGATCTGGATTCTTTAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-2283s1c1
Sequence:CCGGCCCAGAAAGTAACAATGACAACTCGAGTTGTCATTGTTACTTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-821s1c1
Sequence:CCGGGTCCTTTAATAGGACTCCTAACTCGAGTTAGGAGTCCTATTAAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-350s1c1
Sequence:CCGGCCAGTATCAATCTAGAGCACACTCGAGTGTGCTCTAGATTGATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016599.3-1208s21c1
Sequence:CCGGTCACTTGTCTTCATTCATAATCTCGAGATTATGAATGAAGACAAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-782s1c1
Sequence:CCGGCAGGTTTATGTCCTTTGTCAACTCGAGTTGACAAAGGACATAAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016599
MYOZ2 MISSION shRNA shRNA Plasmid DNA
myozenin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016599.3-750s21c1
Sequence:CCGGGCCTGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-294s1c1
Sequence:CCGGGCCAGGCTATTTAAGATGCGTCTCGAGACGCATCTTAAATAGCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-1156s1c1
Sequence:CCGGCCTGGTTTAAAGAATCCAGATCTCGAGATCTGGATTCTTTAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-2283s1c1
Sequence:CCGGCCCAGAAAGTAACAATGACAACTCGAGTTGTCATTGTTACTTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-821s1c1
Sequence:CCGGGTCCTTTAATAGGACTCCTAACTCGAGTTAGGAGTCCTATTAAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-350s1c1
Sequence:CCGGCCAGTATCAATCTAGAGCACACTCGAGTGTGCTCTAGATTGATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016599.3-1208s21c1
Sequence:CCGGTCACTTGTCTTCATTCATAATCTCGAGATTATGAATGAAGACAAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-782s1c1
Sequence:CCGGCAGGTTTATGTCCTTTGTCAACTCGAGTTGACAAAGGACATAAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016599
MYOZ2 MISSION shRNA Lentiviral Transduction Particles
myozenin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016599.3-750s21c1
Sequence:CCGGGCCTGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-294s1c1
Sequence:CCGGGCCAGGCTATTTAAGATGCGTCTCGAGACGCATCTTAAATAGCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-1156s1c1
Sequence:CCGGCCTGGTTTAAAGAATCCAGATCTCGAGATCTGGATTCTTTAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016599.2-2283s1c1
Sequence:CCGGCCCAGAAAGTAACAATGACAACTCGAGTTGTCATTGTTACTTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-821s1c1
Sequence:CCGGGTCCTTTAATAGGACTCCTAACTCGAGTTAGGAGTCCTATTAAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-350s1c1
Sequence:CCGGCCAGTATCAATCTAGAGCACACTCGAGTGTGCTCTAGATTGATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016599.3-1208s21c1
Sequence:CCGGTCACTTGTCTTCATTCATAATCTCGAGATTATGAATGAAGACAAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016599.2-782s1c1
Sequence:CCGGCAGGTTTATGTCCTTTGTCAACTCGAGTTGACAAAGGACATAAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021503
MYOZ2 MISSION shRNA Bacterial Glycerol Stock
myozenin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021503.1-956s1c1
Sequence:CCGGCCACAGGAAGTTCTGCACATACTCGAGTATGTGCAGAACTTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-679s1c1
Sequence:CCGGTGCGGGATTACAGGAGCTTTACTCGAGTAAAGCTCCTGTAATCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-337s1c1
Sequence:CCGGCTGACAAATACACCTTTGAAACTCGAGTTTCAAAGGTGTATTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-680s1c1
Sequence:CCGGGCGGGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-272s1c1
Sequence:CCGGGATAGAAGAATTGTCCCATTTCTCGAGAAATGGGACAATTCTTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021503
MYOZ2 MISSION shRNA shRNA Plasmid DNA
myozenin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021503.1-956s1c1
Sequence:CCGGCCACAGGAAGTTCTGCACATACTCGAGTATGTGCAGAACTTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-679s1c1
Sequence:CCGGTGCGGGATTACAGGAGCTTTACTCGAGTAAAGCTCCTGTAATCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-337s1c1
Sequence:CCGGCTGACAAATACACCTTTGAAACTCGAGTTTCAAAGGTGTATTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-680s1c1
Sequence:CCGGGCGGGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-272s1c1
Sequence:CCGGGATAGAAGAATTGTCCCATTTCTCGAGAAATGGGACAATTCTTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021503
MYOZ2 MISSION shRNA Lentiviral Transduction Particles
myozenin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021503.1-956s1c1
Sequence:CCGGCCACAGGAAGTTCTGCACATACTCGAGTATGTGCAGAACTTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-679s1c1
Sequence:CCGGTGCGGGATTACAGGAGCTTTACTCGAGTAAAGCTCCTGTAATCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-337s1c1
Sequence:CCGGCTGACAAATACACCTTTGAAACTCGAGTTTCAAAGGTGTATTTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-680s1c1
Sequence:CCGGGCGGGATTACAGGAGCTTTAACTCGAGTTAAAGCTCCTGTAATCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021503.1-272s1c1
Sequence:CCGGGATAGAAGAATTGTCCCATTTCTCGAGAAATGGGACAATTCTTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)