EMAIL THIS PAGE TO A FRIEND

MYOZ3

myozenin 3

63 Gene Product Result for
Synonyms: CS-3 CS3 FRP3
UniProtKB ID: Q8TDC0, B2R9Q4, D3DQG9, Q8IVM1, Q8IVN1
Gene ID:
Human(91977) Summary: The protein encoded by this gene is specifically expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]
Mouse(170947) myozenin 3
Rat(689274) myozenin 3
chicken(416271) myozenin 3
cow(613741) myozenin 3
dog(610340) myozenin 3
sheep(100528014) myozenin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019201 MISSION® esiRNA esiRNA targeting mouse Myoz3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122853 Rosetta Predictions human pricing
NM_133371 Rosetta Predictions human pricing
XM_001070223 Rosetta Predictions rat pricing
NM_133363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327517 predicted 1143
2 SASI_Hs02_00327518 predicted 816
3 SASI_Hs02_00327519 predicted 1146
4 SASI_Hs02_00327520 predicted 1254
5 SASI_Hs02_00327521 predicted 1106
6 SASI_Hs02_00327522 predicted 1005
7 SASI_Hs02_00327523 predicted 1402
8 SASI_Hs02_00327524 predicted 758
9 SASI_Hs02_00327525 predicted 1270
10 SASI_Hs02_00327526 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143717 predicted 797
2 SASI_Hs02_00363065 predicted 708
3 SASI_Hs01_00143722 predicted 801
4 SASI_Hs01_00143724 predicted 765
5 SASI_Hs02_00363066 predicted 730
6 SASI_Hs02_00363067 predicted 505
7 SASI_Hs02_00363068 predicted 542
8 SASI_Hs02_00363069 predicted 441
9 SASI_Hs02_00363070 predicted 690
10 SASI_Hs01_00143720 predicted 643
11 SASI_Hs01_00143718 predicted 384
12 SASI_Hs01_00143719 predicted 368
13 SASI_Hs01_00143721 predicted 381
14 SASI_Hs01_00143723 predicted 871
15 SASI_Hs01_00143725 predicted 699
16 SASI_Hs01_00143726 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330864 predicted 223
2 SASI_Rn02_00330865 predicted 199
3 SASI_Rn02_00330866 predicted 424
4 SASI_Rn02_00330867 predicted 507
5 SASI_Rn02_00330868 predicted 570
6 SASI_Rn02_00330869 predicted 241
7 SASI_Rn02_00330870 predicted 277
8 SASI_Rn02_00330871 predicted 216
9 SASI_Rn02_00330872 predicted 462
10 SASI_Rn02_00330873 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186555 predicted 315
2 SASI_Mm01_00186557 predicted 275
3 SASI_Mm01_00186558 predicted 316
4 SASI_Mm01_00186559 predicted 322
5 SASI_Mm01_00186560 predicted 602
6 SASI_Mm01_00186561 predicted 645
7 SASI_Mm01_00186562 predicted 209
8 SASI_Mm01_00186563 predicted 589
9 SASI_Mm01_00186564 predicted 293
10 SASI_Mm02_00338546 predicted 269
11 SASI_Mm01_00186556 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133371
MYOZ3 MISSION shRNA Bacterial Glycerol Stock
myozenin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133371.2-2755s1c1
Sequence:CCGGCCTCTGTTTCTCCAAGTGTAACTCGAGTTACACTTGGAGAAACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-380s1c1
Sequence:CCGGGCAGAAGTTCACTTTCGAGTTCTCGAGAACTCGAAAGTGAACTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-653s1c1
Sequence:CCGGCCCGCCAGAGAAGTTCAACCACTCGAGTGGTTGAACTTCTCTGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-322s1c1
Sequence:CCGGAGCTGTCACTACGCAACAACACTCGAGTGTTGTTGCGTAGTGACAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-770s1c1
Sequence:CCGGCGACTACCGAAATTTCAACAACTCGAGTTGTTGAAATTTCGGTAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133371.3-1237s21c1
Sequence:CCGGAGTCGAGGAATCTGTATTATTCTCGAGAATAATACAGATTCCTCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-988s21c1
Sequence:CCGGAGCTGTAGCCCTAGCCTGAATCTCGAGATTCAGGCTAGGGCTACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-740s21c1
Sequence:CCGGTTGGCAGGAGTTCGTCAGCTACTCGAGTAGCTGACGAACTCCTGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-286s21c1
Sequence:CCGGACCTCACTGAACCAGTCCCTACTCGAGTAGGGACTGGTTCAGTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133371
MYOZ3 MISSION shRNA shRNA Plasmid DNA
myozenin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133371.2-2755s1c1
Sequence:CCGGCCTCTGTTTCTCCAAGTGTAACTCGAGTTACACTTGGAGAAACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-380s1c1
Sequence:CCGGGCAGAAGTTCACTTTCGAGTTCTCGAGAACTCGAAAGTGAACTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-653s1c1
Sequence:CCGGCCCGCCAGAGAAGTTCAACCACTCGAGTGGTTGAACTTCTCTGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-322s1c1
Sequence:CCGGAGCTGTCACTACGCAACAACACTCGAGTGTTGTTGCGTAGTGACAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-770s1c1
Sequence:CCGGCGACTACCGAAATTTCAACAACTCGAGTTGTTGAAATTTCGGTAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133371.3-1237s21c1
Sequence:CCGGAGTCGAGGAATCTGTATTATTCTCGAGAATAATACAGATTCCTCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-988s21c1
Sequence:CCGGAGCTGTAGCCCTAGCCTGAATCTCGAGATTCAGGCTAGGGCTACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-740s21c1
Sequence:CCGGTTGGCAGGAGTTCGTCAGCTACTCGAGTAGCTGACGAACTCCTGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-286s21c1
Sequence:CCGGACCTCACTGAACCAGTCCCTACTCGAGTAGGGACTGGTTCAGTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133371
MYOZ3 MISSION shRNA Lentiviral Transduction Particles
myozenin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133371.2-2755s1c1
Sequence:CCGGCCTCTGTTTCTCCAAGTGTAACTCGAGTTACACTTGGAGAAACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-380s1c1
Sequence:CCGGGCAGAAGTTCACTTTCGAGTTCTCGAGAACTCGAAAGTGAACTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-653s1c1
Sequence:CCGGCCCGCCAGAGAAGTTCAACCACTCGAGTGGTTGAACTTCTCTGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-322s1c1
Sequence:CCGGAGCTGTCACTACGCAACAACACTCGAGTGTTGTTGCGTAGTGACAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133371.2-770s1c1
Sequence:CCGGCGACTACCGAAATTTCAACAACTCGAGTTGTTGAAATTTCGGTAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133371.3-1237s21c1
Sequence:CCGGAGTCGAGGAATCTGTATTATTCTCGAGAATAATACAGATTCCTCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-988s21c1
Sequence:CCGGAGCTGTAGCCCTAGCCTGAATCTCGAGATTCAGGCTAGGGCTACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-740s21c1
Sequence:CCGGTTGGCAGGAGTTCGTCAGCTACTCGAGTAGCTGACGAACTCCTGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133371.3-286s21c1
Sequence:CCGGACCTCACTGAACCAGTCCCTACTCGAGTAGGGACTGGTTCAGTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133363
MYOZ3 MISSION shRNA Bacterial Glycerol Stock
myozenin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-276s1c1
Sequence:CCGGCGGGTGCAGAAGTTTACCTTTCTCGAGAAAGGTAAACTTCTGCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-281s1c1
Sequence:CCGGGCAGAAGTTTACCTTTGAGCTCTCGAGAGCTCAAAGGTAAACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-292s1c1
Sequence:CCGGCCTTTGAGCTATCAGAAAGTTCTCGAGAACTTTCTGATAGCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-596s1c1
Sequence:CCGGGTTCACCAGCTACCAAGACTACTCGAGTAGTCTTGGTAGCTGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-650s1c1
Sequence:CCGGCCGAGACTATCGCAACTTCAACTCGAGTTGAAGTTGCGATAGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133363
MYOZ3 MISSION shRNA shRNA Plasmid DNA
myozenin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-276s1c1
Sequence:CCGGCGGGTGCAGAAGTTTACCTTTCTCGAGAAAGGTAAACTTCTGCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-281s1c1
Sequence:CCGGGCAGAAGTTTACCTTTGAGCTCTCGAGAGCTCAAAGGTAAACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-292s1c1
Sequence:CCGGCCTTTGAGCTATCAGAAAGTTCTCGAGAACTTTCTGATAGCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-596s1c1
Sequence:CCGGGTTCACCAGCTACCAAGACTACTCGAGTAGTCTTGGTAGCTGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-650s1c1
Sequence:CCGGCCGAGACTATCGCAACTTCAACTCGAGTTGAAGTTGCGATAGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133363
MYOZ3 MISSION shRNA Lentiviral Transduction Particles
myozenin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-276s1c1
Sequence:CCGGCGGGTGCAGAAGTTTACCTTTCTCGAGAAAGGTAAACTTCTGCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-281s1c1
Sequence:CCGGGCAGAAGTTTACCTTTGAGCTCTCGAGAGCTCAAAGGTAAACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-292s1c1
Sequence:CCGGCCTTTGAGCTATCAGAAAGTTCTCGAGAACTTTCTGATAGCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-596s1c1
Sequence:CCGGGTTCACCAGCTACCAAGACTACTCGAGTAGTCTTGGTAGCTGGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133363.1-650s1c1
Sequence:CCGGCCGAGACTATCGCAACTTCAACTCGAGTTGAAGTTGCGATAGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)