EMAIL THIS PAGE TO A FRIEND

MYPN

myopalladin

130 Gene Product Result for
Synonyms: CMD1DD CMH22 MYOP RCM4
Gene ID:
Human(84665) Summary: Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Mouse(68802) myopalladin
Rat(309760) myopalladin
sheep(101104119) myopalladin
Zebrafish(571695) myopalladin
dog(489013) myopalladin
cow(527123) myopalladin
Horse(100072581) myopalladin
chicken(423684) myopalladin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032578 Rosetta Predictions human pricing
NM_001107628 Rosetta Predictions rat pricing
XM_483911 Rosetta Predictions mouse pricing
XM_905765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150502 predicted 1276
2 SASI_Hs01_00150504 predicted 2244
3 SASI_Hs01_00150505 predicted 568
4 SASI_Hs01_00150507 predicted 4165
5 SASI_Hs02_00360099 predicted 2220
6 SASI_Hs01_00150508 predicted 3137
7 SASI_Hs01_00150509 predicted 1085
8 SASI_Hs01_00150510 predicted 444
9 SASI_Hs01_00150511 predicted 3238
10 SASI_Hs02_00360100 predicted 1838
11 SASI_Hs01_00150503 predicted 1451
12 SASI_Hs01_00150506 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230705 predicted 2170
2 SASI_Rn02_00230706 predicted 2717
3 SASI_Rn02_00230707 predicted 912
4 SASI_Rn02_00230708 predicted 3966
5 SASI_Rn02_00230709 predicted 2835
6 SASI_Rn02_00230710 predicted 1796
7 SASI_Rn02_00230711 predicted 2779
8 SASI_Rn02_00230712 predicted 835
9 SASI_Rn02_00230713 predicted 1915
10 SASI_Rn02_00230714 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224817 predicted 4212
2 SASI_Mm01_00224818 predicted 3956
3 SASI_Mm01_00224819 predicted 4470
4 SASI_Mm01_00224820 predicted 4605
5 SASI_Mm01_00224821 predicted 4047
6 SASI_Mm01_00224822 predicted 4349
7 SASI_Mm01_00224823 predicted 4105
8 SASI_Mm01_00224824 predicted 4540
9 SASI_Mm01_00224825 predicted 4462
10 SASI_Mm01_00224826 predicted 3955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432060 predicted 2421
2 SASI_Mm02_00432061 predicted 193
3 SASI_Mm02_00432062 predicted 3091
4 SASI_Mm02_00432063 predicted 2037
5 SASI_Mm02_00432064 predicted 2578
6 SASI_Mm02_00432065 predicted 2800
7 SASI_Mm02_00432066 predicted 1448
8 SASI_Mm02_00432067 predicted 1057
9 SASI_Mm02_00432068 predicted 397
10 SASI_Mm02_00432069 predicted 1240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032578
VALIDATED
MYPN MISSION shRNA Bacterial Glycerol Stock
myopalladin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-2967s21c1
Sequence:CCGGTGATGAATGAAATAGAGTTTCCTCGAGGAAACTCTATTTCATTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-544s21c1
Sequence:CCGGGATGAAACACTCACCTAATTTCTCGAGAAATTAGGTGAGTGTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032578.2-4631s21c1
Sequence:CCGGACCATCACCTTTCATCGATTACTCGAGTAATCGATGAAAGGTGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032578.1-5029s1c1
Sequence:CCGGGCCACATAATAAGGTGTCAAACTCGAGTTTGACACCTTATTATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-3368s1c1
Sequence:CCGGCCAGTCACATTCACCTGCAAACTCGAGTTTGCAGGTGAATGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032578.1-1591s1c1
Sequence:CCGGCGACCCTAACAAGGAAGAGATCTCGAGATCTCTTCCTTGTTAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-4398s1c1
Sequence:CCGGCGATGGTGTATTCATGCTCTTCTCGAGAAGAGCATGAATACACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-950s1c1
Sequence:CCGGGCCGACTTCATTGAAGAGCTACTCGAGTAGCTCTTCAATGAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032578
VALIDATED
MYPN MISSION shRNA shRNA Plasmid DNA
myopalladin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-2967s21c1
Sequence:CCGGTGATGAATGAAATAGAGTTTCCTCGAGGAAACTCTATTTCATTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-544s21c1
Sequence:CCGGGATGAAACACTCACCTAATTTCTCGAGAAATTAGGTGAGTGTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032578.2-4631s21c1
Sequence:CCGGACCATCACCTTTCATCGATTACTCGAGTAATCGATGAAAGGTGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032578.1-5029s1c1
Sequence:CCGGGCCACATAATAAGGTGTCAAACTCGAGTTTGACACCTTATTATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-3368s1c1
Sequence:CCGGCCAGTCACATTCACCTGCAAACTCGAGTTTGCAGGTGAATGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032578.1-1591s1c1
Sequence:CCGGCGACCCTAACAAGGAAGAGATCTCGAGATCTCTTCCTTGTTAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-4398s1c1
Sequence:CCGGCGATGGTGTATTCATGCTCTTCTCGAGAAGAGCATGAATACACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-950s1c1
Sequence:CCGGGCCGACTTCATTGAAGAGCTACTCGAGTAGCTCTTCAATGAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032578
VALIDATED
MYPN MISSION shRNA Lentiviral Transduction Particles
myopalladin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-2967s21c1
Sequence:CCGGTGATGAATGAAATAGAGTTTCCTCGAGGAAACTCTATTTCATTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032578.2-544s21c1
Sequence:CCGGGATGAAACACTCACCTAATTTCTCGAGAAATTAGGTGAGTGTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032578.2-4631s21c1
Sequence:CCGGACCATCACCTTTCATCGATTACTCGAGTAATCGATGAAAGGTGATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032578.1-5029s1c1
Sequence:CCGGGCCACATAATAAGGTGTCAAACTCGAGTTTGACACCTTATTATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-3368s1c1
Sequence:CCGGCCAGTCACATTCACCTGCAAACTCGAGTTTGCAGGTGAATGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032578.1-1591s1c1
Sequence:CCGGCGACCCTAACAAGGAAGAGATCTCGAGATCTCTTCCTTGTTAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-4398s1c1
Sequence:CCGGCGATGGTGTATTCATGCTCTTCTCGAGAAGAGCATGAATACACCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032578.1-950s1c1
Sequence:CCGGGCCGACTTCATTGAAGAGCTACTCGAGTAGCTCTTCAATGAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182992
MYPN MISSION shRNA Bacterial Glycerol Stock
myopalladin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-2787s21c1
Sequence:CCGGGTACCATCCCAGGGTCTAATGCTCGAGCATTAGACCCTGGGATGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182992.2-4375s21c1
Sequence:CCGGTGCCAGCCAGTAGACAATATACTCGAGTATATTGTCTACTGGCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3001s21c1
Sequence:CCGGACGAATCTGATGACGAGATAGCTCGAGCTATCTCGTCATCAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-895s21c1
Sequence:CCGGACGAGCTGAACCACGCTATTGCTCGAGCAATAGCGTGGTTCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3992s21c1
Sequence:CCGGCACAGCTAGGTTGGATATATACTCGAGTATATATCCAACCTAGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182992
MYPN MISSION shRNA shRNA Plasmid DNA
myopalladin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-2787s21c1
Sequence:CCGGGTACCATCCCAGGGTCTAATGCTCGAGCATTAGACCCTGGGATGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182992.2-4375s21c1
Sequence:CCGGTGCCAGCCAGTAGACAATATACTCGAGTATATTGTCTACTGGCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3001s21c1
Sequence:CCGGACGAATCTGATGACGAGATAGCTCGAGCTATCTCGTCATCAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-895s21c1
Sequence:CCGGACGAGCTGAACCACGCTATTGCTCGAGCAATAGCGTGGTTCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3992s21c1
Sequence:CCGGCACAGCTAGGTTGGATATATACTCGAGTATATATCCAACCTAGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182992
MYPN MISSION shRNA Lentiviral Transduction Particles
myopalladin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-2787s21c1
Sequence:CCGGGTACCATCCCAGGGTCTAATGCTCGAGCATTAGACCCTGGGATGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182992.2-4375s21c1
Sequence:CCGGTGCCAGCCAGTAGACAATATACTCGAGTATATTGTCTACTGGCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3001s21c1
Sequence:CCGGACGAATCTGATGACGAGATAGCTCGAGCTATCTCGTCATCAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-895s21c1
Sequence:CCGGACGAGCTGAACCACGCTATTGCTCGAGCAATAGCGTGGTTCAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182992.2-3992s21c1
Sequence:CCGGCACAGCTAGGTTGGATATATACTCGAGTATATATCCAACCTAGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)