EMAIL THIS PAGE TO A FRIEND

MYRIP

myosin VIIA and Rab interacting protein

149 Gene Product Result for
Synonyms: SLAC2-C SLAC2C
Gene ID:
Mouse(245049) myosin VIIA and Rab interacting protein
Rat(360034) myosin VIIA and Rab interacting protein
Zebrafish(567049) myosin VIIA and Rab interacting protein
dog(485603) myosin VIIA and Rab interacting protein
Horse(100068066) myosin VIIA and Rab interacting protein
cow(522113) myosin VIIA and Rab interacting protein
domestic cat(101098330) myosin VIIA and Rab interacting protein
chicken(428455) myosin VIIA and Rab interacting protein
sheep(101118310) myosin VIIA and Rab interacting protein
domestic guinea pig(100731499) myosin VIIA and Rab interacting protein
naked mole-rat(101726549) myosin VIIA and Rab interacting protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021351 MISSION® esiRNA esiRNA human MYRIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015460 Rosetta Predictions human pricing
NM_182844 Rosetta Predictions rat pricing
NM_144557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148635 predicted 2501
2 SASI_Hs01_00148636 predicted 1225
3 SASI_Hs01_00148637 predicted 2065
4 SASI_Hs01_00148638 predicted 200
5 SASI_Hs01_00148639 predicted 2512
6 SASI_Hs02_00347877 predicted 2407
7 SASI_Hs01_00148640 predicted 723
8 SASI_Hs01_00148641 predicted 2397
9 SASI_Hs01_00148642 predicted 2599
10 SASI_Hs01_00148643 predicted 472
11 SASI_Hs01_00148644 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269858 predicted 1900
2 SASI_Rn01_00067062 predicted 2339
3 SASI_Rn01_00067064 predicted 378
4 SASI_Rn02_00269859 predicted 1900
5 SASI_Rn01_00067065 predicted 1063
6 SASI_Rn01_00067066 predicted 746
7 SASI_Rn01_00067067 predicted 1892
8 SASI_Rn01_00067068 predicted 1356
9 SASI_Rn02_00269860 predicted 1998
10 SASI_Rn01_00067069 predicted 282
11 SASI_Rn01_00067060 predicted 592
12 SASI_Rn01_00067061 predicted 2031
13 SASI_Rn01_00067063 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340102 predicted 231
2 SASI_Mm02_00340103 predicted 2062
3 SASI_Mm02_00340104 predicted 2086
4 SASI_Mm02_00340105 predicted 624
5 SASI_Mm02_00340106 predicted 1618
6 SASI_Mm02_00340107 predicted 687
7 SASI_Mm02_00340108 predicted 655
8 SASI_Mm02_00340109 predicted 515
9 SASI_Mm02_00340110 predicted 1896
10 SASI_Mm02_00340111 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015460
MYRIP MISSION shRNA Bacterial Glycerol Stock
myosin VIIA and Rab interacting protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2402s21c1
Sequence:CCGGCAGATATTGAGAGCCGGATTTCTCGAGAAATCCGGCTCTCAATATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015460.2-3067s21c1
Sequence:CCGGTAGTATTCCATGTCAACAATTCTCGAGAATTGTTGACATGGAATACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2580s21c1
Sequence:CCGGATCTTCAGTGACTACCATTAACTCGAGTTAATGGTAGTCACTGAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015460.2-4588s1c1
Sequence:CCGGGCCAAATAAGTGCAAAGATTTCTCGAGAAATCTTTGCACTTATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-2498s1c1
Sequence:CCGGCCCAGGTACAAACCATAGATACTCGAGTATCTATGGTTTGTACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-590s1c1
Sequence:CCGGGCTTCGACATTCTAGGAGGAACTCGAGTTCCTCCTAGAATGTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-1893s1c1
Sequence:CCGGGCTGTACGAGTTAGCAATGAACTCGAGTTCATTGCTAACTCGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-855s1c1
Sequence:CCGGCCTGCAGAAGATTATACGAAACTCGAGTTTCGTATAATCTTCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015460
MYRIP MISSION shRNA shRNA Plasmid DNA
myosin VIIA and Rab interacting protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2402s21c1
Sequence:CCGGCAGATATTGAGAGCCGGATTTCTCGAGAAATCCGGCTCTCAATATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015460.2-3067s21c1
Sequence:CCGGTAGTATTCCATGTCAACAATTCTCGAGAATTGTTGACATGGAATACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2580s21c1
Sequence:CCGGATCTTCAGTGACTACCATTAACTCGAGTTAATGGTAGTCACTGAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015460.2-4588s1c1
Sequence:CCGGGCCAAATAAGTGCAAAGATTTCTCGAGAAATCTTTGCACTTATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-2498s1c1
Sequence:CCGGCCCAGGTACAAACCATAGATACTCGAGTATCTATGGTTTGTACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-590s1c1
Sequence:CCGGGCTTCGACATTCTAGGAGGAACTCGAGTTCCTCCTAGAATGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-1893s1c1
Sequence:CCGGGCTGTACGAGTTAGCAATGAACTCGAGTTCATTGCTAACTCGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-855s1c1
Sequence:CCGGCCTGCAGAAGATTATACGAAACTCGAGTTTCGTATAATCTTCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015460
MYRIP MISSION shRNA Lentiviral Transduction Particles
myosin VIIA and Rab interacting protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2402s21c1
Sequence:CCGGCAGATATTGAGAGCCGGATTTCTCGAGAAATCCGGCTCTCAATATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015460.2-3067s21c1
Sequence:CCGGTAGTATTCCATGTCAACAATTCTCGAGAATTGTTGACATGGAATACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015460.2-2580s21c1
Sequence:CCGGATCTTCAGTGACTACCATTAACTCGAGTTAATGGTAGTCACTGAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015460.2-4588s1c1
Sequence:CCGGGCCAAATAAGTGCAAAGATTTCTCGAGAAATCTTTGCACTTATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-2498s1c1
Sequence:CCGGCCCAGGTACAAACCATAGATACTCGAGTATCTATGGTTTGTACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-590s1c1
Sequence:CCGGGCTTCGACATTCTAGGAGGAACTCGAGTTCCTCCTAGAATGTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-1893s1c1
Sequence:CCGGGCTGTACGAGTTAGCAATGAACTCGAGTTCATTGCTAACTCGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015460.2-855s1c1
Sequence:CCGGCCTGCAGAAGATTATACGAAACTCGAGTTTCGTATAATCTTCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144557
MYRIP MISSION shRNA Bacterial Glycerol Stock
myosin VIIA and Rab interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-3168s21c1
Sequence:CCGGCCATCACTTAGTCGTGCTTATCTCGAGATAAGCACGACTAAGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-2964s21c1
Sequence:CCGGGGGAATTTGAGACCGAATATCCTCGAGGATATTCGGTCTCAAATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144557.5-2444s21c1
Sequence:CCGGCCTGACCATCGCTGGCTTAAACTCGAGTTTAAGCCAGCGATGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-633s1c1
Sequence:CCGGAGGAGGATTGTTTGAACCAAACTCGAGTTTGGTTCAAACAATCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-232s1c1
Sequence:CCGGAGAGACTTCAATCTTCGCAAACTCGAGTTTGCGAAGATTGAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1912s1c1
Sequence:CCGGCTGTATGAGTTAGCCATGAAACTCGAGTTTCATGGCTAACTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144557.2-3553s1c1
Sequence:CCGGCCTGCCAAATTCAACAAGATTCTCGAGAATCTTGTTGAATTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1508s1c1
Sequence:CCGGGCTCGGATTCAGAGACATCTTCTCGAGAAGATGTCTCTGAATCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144557
MYRIP MISSION shRNA shRNA Plasmid DNA
myosin VIIA and Rab interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-3168s21c1
Sequence:CCGGCCATCACTTAGTCGTGCTTATCTCGAGATAAGCACGACTAAGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-2964s21c1
Sequence:CCGGGGGAATTTGAGACCGAATATCCTCGAGGATATTCGGTCTCAAATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144557.5-2444s21c1
Sequence:CCGGCCTGACCATCGCTGGCTTAAACTCGAGTTTAAGCCAGCGATGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-633s1c1
Sequence:CCGGAGGAGGATTGTTTGAACCAAACTCGAGTTTGGTTCAAACAATCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-232s1c1
Sequence:CCGGAGAGACTTCAATCTTCGCAAACTCGAGTTTGCGAAGATTGAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1912s1c1
Sequence:CCGGCTGTATGAGTTAGCCATGAAACTCGAGTTTCATGGCTAACTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144557.2-3553s1c1
Sequence:CCGGCCTGCCAAATTCAACAAGATTCTCGAGAATCTTGTTGAATTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1508s1c1
Sequence:CCGGGCTCGGATTCAGAGACATCTTCTCGAGAAGATGTCTCTGAATCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144557
MYRIP MISSION shRNA Lentiviral Transduction Particles
myosin VIIA and Rab interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-3168s21c1
Sequence:CCGGCCATCACTTAGTCGTGCTTATCTCGAGATAAGCACGACTAAGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144557.5-2964s21c1
Sequence:CCGGGGGAATTTGAGACCGAATATCCTCGAGGATATTCGGTCTCAAATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144557.5-2444s21c1
Sequence:CCGGCCTGACCATCGCTGGCTTAAACTCGAGTTTAAGCCAGCGATGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-633s1c1
Sequence:CCGGAGGAGGATTGTTTGAACCAAACTCGAGTTTGGTTCAAACAATCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-232s1c1
Sequence:CCGGAGAGACTTCAATCTTCGCAAACTCGAGTTTGCGAAGATTGAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1912s1c1
Sequence:CCGGCTGTATGAGTTAGCCATGAAACTCGAGTTTCATGGCTAACTCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144557.2-3553s1c1
Sequence:CCGGCCTGCCAAATTCAACAAGATTCTCGAGAATCTTGTTGAATTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144557.2-1508s1c1
Sequence:CCGGGCTCGGATTCAGAGACATCTTCTCGAGAAGATGTCTCTGAATCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)