EMAIL THIS PAGE TO A FRIEND

MYT1

myelin transcription factor 1

339 Gene Product Result for
Synonyms: C20orf36 MTF1 MYTI PLPB1 ZC2HC4A
UniProtKB ID: Q01538, E1P5H0, O94922, Q9UPV2
Gene ID:
Human(4661) Summary: The protein encoded by this gene is a member of a family of neural specific, zinc finger-containing DNA-binding proteins. The protein binds to the promoter regions of proteolipid proteins of the central nervous system and plays a role in the developing nervous system. [provided by RefSeq, Jul 2008]
Mouse(17932) myelin transcription factor 1
Rat(362291) myelin transcription factor 1
naked mole-rat(101708377) myelin transcription factor 1
domestic guinea pig(100726615) myelin transcription factor 1
sheep(101106866) myelin transcription factor 1
fruit fly(38649) CG32417 gene product from transcript CG32417-RA
cow(505552) myelin transcription factor 1
Horse(100051884) myelin transcription factor 1
domestic cat(101093764) myelin transcription factor 1
dog(485987) myelin transcription factor 1
chicken(419249) myelin transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004535 Rosetta Predictions human pricing
NM_001108615 Rosetta Predictions rat pricing
NM_008665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111924 predicted 1640
2 SASI_Hs01_00111925 predicted 3574
3 SASI_Hs01_00111926 predicted 3146
4 SASI_Hs01_00111927 predicted 1661
5 SASI_Hs01_00111928 predicted 3076
6 SASI_Hs01_00111929 predicted 2167
7 SASI_Hs01_00111930 predicted 1954
8 SASI_Hs01_00111931 predicted 1638
9 SASI_Hs01_00111932 predicted 2095
10 SASI_Hs01_00111933 predicted 3557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240379 predicted 2344
2 SASI_Rn02_00240380 predicted 3689
3 SASI_Rn02_00240381 predicted 2222
4 SASI_Rn02_00240382 predicted 2168
5 SASI_Rn02_00240383 predicted 1873
6 SASI_Rn02_00240384 predicted 1657
7 SASI_Rn02_00240385 predicted 2114
8 SASI_Rn02_00240386 predicted 2946
9 SASI_Rn02_00240387 predicted 3532
10 SASI_Rn02_00240388 predicted 3608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048233 predicted 2742
2 SASI_Mm01_00048234 predicted 2330
3 SASI_Mm01_00048236 predicted 2249
4 SASI_Mm01_00048238 predicted 2206
5 SASI_Mm01_00048239 predicted 2974
6 SASI_Mm01_00048240 predicted 3170
7 SASI_Mm01_00048241 predicted 1960
8 SASI_Mm02_00314421 predicted 1689
9 SASI_Mm02_00314422 predicted 2498
10 SASI_Mm01_00048242 predicted 3645
11 SASI_Mm01_00048235 predicted 540
12 SASI_Mm01_00048237 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008665
MYT1 MISSION shRNA Bacterial Glycerol Stock
myelin transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1202s21c1
Sequence:CCGGAGGAGGAGGAAGAAGATGAAGCTCGAGCTTCATCTTCTTCCTCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1286s21c1
Sequence:CCGGAGGAAGAAGAGGAGGAGGAAGCTCGAGCTTCCTCCTCCTCTTCTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1298s21c1
Sequence:CCGGAGGAGGAAGATGAAGAGGAAGCTCGAGCTTCCTCTTCATCTTCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1260s21c1
Sequence:CCGGAGGAGAAGAAGAAGAGGAGGACTCGAGTCCTCCTCTTCTTCTTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1219s21c1
Sequence:CCGGGAAGAAGAAGAGGATGAGGAGCTCGAGCTCCTCATCCTCTTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008665.2-5011s1c1
Sequence:CCGGGCCACAAAGAATCTTGATATACTCGAGTATATCAAGATTCTTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3441s1c1
Sequence:CCGGCGAGACTTAAATGAGTCCAATCTCGAGATTGGACTCATTTAAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1908s1c1
Sequence:CCGGCGCAATACTCACAGAAGTTTACTCGAGTAAACTTCTGTGAGTATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3442s1c1
Sequence:CCGGGAGACTTAAATGAGTCCAATTCTCGAGAATTGGACTCATTTAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1397s1c1
Sequence:CCGGCCCAGAGCTATCTAGTCCTAACTCGAGTTAGGACTAGATAGCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008665
MYT1 MISSION shRNA shRNA Plasmid DNA
myelin transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1202s21c1
Sequence:CCGGAGGAGGAGGAAGAAGATGAAGCTCGAGCTTCATCTTCTTCCTCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1286s21c1
Sequence:CCGGAGGAAGAAGAGGAGGAGGAAGCTCGAGCTTCCTCCTCCTCTTCTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1298s21c1
Sequence:CCGGAGGAGGAAGATGAAGAGGAAGCTCGAGCTTCCTCTTCATCTTCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1260s21c1
Sequence:CCGGAGGAGAAGAAGAAGAGGAGGACTCGAGTCCTCCTCTTCTTCTTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1219s21c1
Sequence:CCGGGAAGAAGAAGAGGATGAGGAGCTCGAGCTCCTCATCCTCTTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008665.2-5011s1c1
Sequence:CCGGGCCACAAAGAATCTTGATATACTCGAGTATATCAAGATTCTTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3441s1c1
Sequence:CCGGCGAGACTTAAATGAGTCCAATCTCGAGATTGGACTCATTTAAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1908s1c1
Sequence:CCGGCGCAATACTCACAGAAGTTTACTCGAGTAAACTTCTGTGAGTATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3442s1c1
Sequence:CCGGGAGACTTAAATGAGTCCAATTCTCGAGAATTGGACTCATTTAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1397s1c1
Sequence:CCGGCCCAGAGCTATCTAGTCCTAACTCGAGTTAGGACTAGATAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008665
MYT1 MISSION shRNA Lentiviral Transduction Particles
myelin transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1202s21c1
Sequence:CCGGAGGAGGAGGAAGAAGATGAAGCTCGAGCTTCATCTTCTTCCTCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1286s21c1
Sequence:CCGGAGGAAGAAGAGGAGGAGGAAGCTCGAGCTTCCTCCTCCTCTTCTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1298s21c1
Sequence:CCGGAGGAGGAAGATGAAGAGGAAGCTCGAGCTTCCTCTTCATCTTCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1260s21c1
Sequence:CCGGAGGAGAAGAAGAAGAGGAGGACTCGAGTCCTCCTCTTCTTCTTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008665.4-1219s21c1
Sequence:CCGGGAAGAAGAAGAGGATGAGGAGCTCGAGCTCCTCATCCTCTTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008665.2-5011s1c1
Sequence:CCGGGCCACAAAGAATCTTGATATACTCGAGTATATCAAGATTCTTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3441s1c1
Sequence:CCGGCGAGACTTAAATGAGTCCAATCTCGAGATTGGACTCATTTAAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1908s1c1
Sequence:CCGGCGCAATACTCACAGAAGTTTACTCGAGTAAACTTCTGTGAGTATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-3442s1c1
Sequence:CCGGGAGACTTAAATGAGTCCAATTCTCGAGAATTGGACTCATTTAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008665.2-1397s1c1
Sequence:CCGGCCCAGAGCTATCTAGTCCTAACTCGAGTTAGGACTAGATAGCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004535
MYT1 MISSION shRNA Bacterial Glycerol Stock
myelin transcription factor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-2114s21c1
Sequence:CCGGACCTTTGACTACGCAAGTTTCCTCGAGGAAACTTGCGTAGTCAAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-3066s21c1
Sequence:CCGGTCGGTCACATCAGCGGGAAATCTCGAGATTTCCCGCTGATGTGACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-1634s1c1
Sequence:CCGGCGGAAGAGTTACTACAGTAAACTCGAGTTTACTGTAGTAACTCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-3613s1c1
Sequence:CCGGCGAACAGAATTTCGATGCCTACTCGAGTAGGCATCGAAATTCTGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004535.2-4184s1c1
Sequence:CCGGGCCGATGAAGAAAGTGCGTTTCTCGAGAAACGCACTTTCTTCATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-2190s1c1
Sequence:CCGGCCTCACCTAAAGCCTTTCAATCTCGAGATTGAAAGGCTTTAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004535
MYT1 MISSION shRNA shRNA Plasmid DNA
myelin transcription factor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-2114s21c1
Sequence:CCGGACCTTTGACTACGCAAGTTTCCTCGAGGAAACTTGCGTAGTCAAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-3066s21c1
Sequence:CCGGTCGGTCACATCAGCGGGAAATCTCGAGATTTCCCGCTGATGTGACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-1634s1c1
Sequence:CCGGCGGAAGAGTTACTACAGTAAACTCGAGTTTACTGTAGTAACTCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-3613s1c1
Sequence:CCGGCGAACAGAATTTCGATGCCTACTCGAGTAGGCATCGAAATTCTGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004535.2-4184s1c1
Sequence:CCGGGCCGATGAAGAAAGTGCGTTTCTCGAGAAACGCACTTTCTTCATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-2190s1c1
Sequence:CCGGCCTCACCTAAAGCCTTTCAATCTCGAGATTGAAAGGCTTTAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004535
MYT1 MISSION shRNA Lentiviral Transduction Particles
myelin transcription factor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-2114s21c1
Sequence:CCGGACCTTTGACTACGCAAGTTTCCTCGAGGAAACTTGCGTAGTCAAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004535.2-3066s21c1
Sequence:CCGGTCGGTCACATCAGCGGGAAATCTCGAGATTTCCCGCTGATGTGACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-1634s1c1
Sequence:CCGGCGGAAGAGTTACTACAGTAAACTCGAGTTTACTGTAGTAACTCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-3613s1c1
Sequence:CCGGCGAACAGAATTTCGATGCCTACTCGAGTAGGCATCGAAATTCTGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004535.2-4184s1c1
Sequence:CCGGGCCGATGAAGAAAGTGCGTTTCTCGAGAAACGCACTTTCTTCATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004535.2-2190s1c1
Sequence:CCGGCCTCACCTAAAGCCTTTCAATCTCGAGATTGAAAGGCTTTAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)