EMAIL THIS PAGE TO A FRIEND

MYT1L

myelin transcription factor 1-like

253 Gene Product Result for
Synonyms: NZF1 ZC2HC4B
UniProtKB ID: Q9UL68, A7E2C7, B2RP54, Q6IQ17, Q9UPP6
Gene ID:
Mouse(17933) myelin transcription factor 1-like
Rat(116668) myelin transcription factor 1-like
Zebrafish(100332876) myelin transcription factor 1-like
dog(482954) myelin transcription factor 1-like
domestic cat(101091863) myelin transcription factor 1-like
cow(537684) myelin transcription factor 1-like
chicken(421915) myelin transcription factor 1-like
sheep(101113208) myelin transcription factor 1-like
domestic guinea pig(100731813) myelin transcription factor 1-like
naked mole-rat(101717418) myelin transcription factor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_039762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_039762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_039762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015025 Rosetta Predictions human pricing
NM_053888 Rosetta Predictions rat pricing
NM_001093775 Rosetta Predictions mouse pricing
NM_001093776 Rosetta Predictions mouse pricing
NM_001093778 Rosetta Predictions mouse pricing
NM_008666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206802 predicted 2052
2 SASI_Hs01_00206804 predicted 3324
3 SASI_Hs01_00206805 predicted 1558
4 SASI_Hs01_00206807 predicted 1805
5 SASI_Hs01_00206808 predicted 3554
6 SASI_Hs01_00206809 predicted 4391
7 SASI_Hs01_00206811 predicted 3555
8 SASI_Hs02_00346820 predicted 2037
9 SASI_Hs02_00346821 predicted 4443
10 SASI_Hs02_00346822 predicted 1698
11 SASI_Hs01_00206803 predicted 4392
12 SASI_Hs01_00206806 predicted 2082
13 SASI_Hs01_00206810 predicted 4097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075995 predicted 1729
2 SASI_Rn01_00075996 predicted 1906
3 SASI_Rn01_00075997 predicted 3907
4 SASI_Rn01_00075998 predicted 1561
5 SASI_Rn01_00075999 predicted 4194
6 SASI_Rn01_00076000 predicted 1835
7 SASI_Rn01_00076001 predicted 1610
8 SASI_Rn01_00076002 predicted 3731
9 SASI_Rn01_00076003 predicted 3295
10 SASI_Rn02_00266809 predicted 4062
11 SASI_Rn01_00076004 predicted 3896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301139 predicted 3658
2 SASI_Mm02_00301140 predicted 2038
3 SASI_Mm02_00301141 predicted 1907
4 SASI_Mm02_00301142 predicted 1685
5 SASI_Mm02_00301143 predicted 4039
6 SASI_Mm02_00301144 predicted 4315
7 SASI_Mm02_00301145 predicted 1960
8 SASI_Mm02_00301146 predicted 3861
9 SASI_Mm02_00301147 predicted 3421
10 SASI_Mm02_00301148 predicted 3146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301149 predicted 3559
2 SASI_Mm02_00301150 predicted 1948
3 SASI_Mm02_00301151 predicted 1815
4 SASI_Mm02_00301152 predicted 1593
5 SASI_Mm02_00301153 predicted 3943
6 SASI_Mm02_00301154 predicted 4220
7 SASI_Mm02_00301155 predicted 1873
8 SASI_Mm02_00301156 predicted 3763
9 SASI_Mm02_00301157 predicted 3333
10 SASI_Mm02_00301158 predicted 4083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301159 predicted 3649
2 SASI_Mm02_00301160 predicted 2032
3 SASI_Mm02_00301161 predicted 1901
4 SASI_Mm02_00301162 predicted 1675
5 SASI_Mm02_00301163 predicted 4033
6 SASI_Mm02_00301164 predicted 4310
7 SASI_Mm02_00301165 predicted 1963
8 SASI_Mm02_00301166 predicted 3847
9 SASI_Mm02_00301167 predicted 3415
10 SASI_Mm02_00301168 predicted 4163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186405 predicted 3654
2 SASI_Mm01_00186406 predicted 2034
3 SASI_Mm01_00186407 predicted 1907
4 SASI_Mm01_00186409 predicted 1677
5 SASI_Mm01_00186408 predicted 4028
6 SASI_Mm01_00186410 predicted 4315
7 SASI_Mm01_00186411 predicted 1962
8 SASI_Mm01_00186412 predicted 3854
9 SASI_Mm01_00186413 predicted 3416
10 SASI_Mm01_00186414 predicted 4171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_039762
MYT1L MISSION shRNA Bacterial Glycerol Stock
myelin transcription factor 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-3999s1c1
Sequence:CCGGCCGATATGATTAAACTCAGAACTCGAGTTCTGAGTTTAATCATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2679s1c1
Sequence:CCGGCCTCGTTTGAATACAACAGTTCTCGAGAACTGTTGTATTCAAACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-971s1c1
Sequence:CCGGCGAAAGCCATTTGCCGTGAAACTCGAGTTTCACGGCAAATGGCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2058s1c1
Sequence:CCGGCCATCGCTTTGGAAACGGAAACTCGAGTTTCCGTTTCCAAAGCGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-1618s1c1
Sequence:CCGGGCAGCAAGACAGTAGAAATATCTCGAGATATTTCTACTGTCTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_039762
MYT1L MISSION shRNA shRNA Plasmid DNA
myelin transcription factor 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-3999s1c1
Sequence:CCGGCCGATATGATTAAACTCAGAACTCGAGTTCTGAGTTTAATCATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2679s1c1
Sequence:CCGGCCTCGTTTGAATACAACAGTTCTCGAGAACTGTTGTATTCAAACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-971s1c1
Sequence:CCGGCGAAAGCCATTTGCCGTGAAACTCGAGTTTCACGGCAAATGGCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2058s1c1
Sequence:CCGGCCATCGCTTTGGAAACGGAAACTCGAGTTTCCGTTTCCAAAGCGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-1618s1c1
Sequence:CCGGGCAGCAAGACAGTAGAAATATCTCGAGATATTTCTACTGTCTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_039762
MYT1L MISSION shRNA Lentiviral Transduction Particles
myelin transcription factor 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-3999s1c1
Sequence:CCGGCCGATATGATTAAACTCAGAACTCGAGTTCTGAGTTTAATCATATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2679s1c1
Sequence:CCGGCCTCGTTTGAATACAACAGTTCTCGAGAACTGTTGTATTCAAACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-971s1c1
Sequence:CCGGCGAAAGCCATTTGCCGTGAAACTCGAGTTTCACGGCAAATGGCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-2058s1c1
Sequence:CCGGCCATCGCTTTGGAAACGGAAACTCGAGTTTCCGTTTCCAAAGCGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039762.5-1618s1c1
Sequence:CCGGGCAGCAAGACAGTAGAAATATCTCGAGATATTTCTACTGTCTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008666
MYT1L MISSION shRNA Bacterial Glycerol Stock
myelin transcription factor 1-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-1856s1c1
Sequence:CCGGCTCGGATATGATGAACCTTATCTCGAGATAAGGTTCATCATATCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-859s1c1
Sequence:CCGGGCAAATATGCACGACACAGAACTCGAGTTCTGTGTCGTGCATATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-2672s1c1
Sequence:CCGGCGACAACCATACTTATGGCAACTCGAGTTGCCATAAGTATGGTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-4172s1c1
Sequence:CCGGCGTGACTACTTTGACGGAAATCTCGAGATTTCCGTCAAAGTAGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008666.1-4374s1c1
Sequence:CCGGCGGAACAGTGTTATGCTACAACTCGAGTTGTAGCATAACACTGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1432s21c1
Sequence:CCGGATGAGTTGTACTCGAATAATGCTCGAGCATTATTCGAGTACAACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1481s21c1
Sequence:CCGGATGATGAGTATGATAACTATGCTCGAGCATAGTTATCATACTCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-3120s21c1
Sequence:CCGGGTCCACACGTTGTCGTGAAATCTCGAGATTTCACGACAACGTGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008666
MYT1L MISSION shRNA shRNA Plasmid DNA
myelin transcription factor 1-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-1856s1c1
Sequence:CCGGCTCGGATATGATGAACCTTATCTCGAGATAAGGTTCATCATATCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-859s1c1
Sequence:CCGGGCAAATATGCACGACACAGAACTCGAGTTCTGTGTCGTGCATATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-2672s1c1
Sequence:CCGGCGACAACCATACTTATGGCAACTCGAGTTGCCATAAGTATGGTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-4172s1c1
Sequence:CCGGCGTGACTACTTTGACGGAAATCTCGAGATTTCCGTCAAAGTAGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008666.1-4374s1c1
Sequence:CCGGCGGAACAGTGTTATGCTACAACTCGAGTTGTAGCATAACACTGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1432s21c1
Sequence:CCGGATGAGTTGTACTCGAATAATGCTCGAGCATTATTCGAGTACAACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1481s21c1
Sequence:CCGGATGATGAGTATGATAACTATGCTCGAGCATAGTTATCATACTCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-3120s21c1
Sequence:CCGGGTCCACACGTTGTCGTGAAATCTCGAGATTTCACGACAACGTGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008666
MYT1L MISSION shRNA Lentiviral Transduction Particles
myelin transcription factor 1-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-1856s1c1
Sequence:CCGGCTCGGATATGATGAACCTTATCTCGAGATAAGGTTCATCATATCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-859s1c1
Sequence:CCGGGCAAATATGCACGACACAGAACTCGAGTTCTGTGTCGTGCATATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-2672s1c1
Sequence:CCGGCGACAACCATACTTATGGCAACTCGAGTTGCCATAAGTATGGTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008666.1-4172s1c1
Sequence:CCGGCGTGACTACTTTGACGGAAATCTCGAGATTTCCGTCAAAGTAGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008666.1-4374s1c1
Sequence:CCGGCGGAACAGTGTTATGCTACAACTCGAGTTGTAGCATAACACTGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1432s21c1
Sequence:CCGGATGAGTTGTACTCGAATAATGCTCGAGCATTATTCGAGTACAACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-1481s21c1
Sequence:CCGGATGATGAGTATGATAACTATGCTCGAGCATAGTTATCATACTCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008666.3-3120s21c1
Sequence:CCGGGTCCACACGTTGTCGTGAAATCTCGAGATTTCACGACAACGTGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)