EMAIL THIS PAGE TO A FRIEND

MYZAP

myocardial zonula adherens protein

19 Gene Product Result for
Synonyms: GCOM1 Gup Gup1 Gup2 MYOZAP
Species: Human MYZAP(100820829), Mouse Myzap(102371), domestic guinea pig Myzap(100717881), naked mole-rat Myzap(101700097), domestic cat MYZAP(101088492)
Gene ID:
Human(100820829) Summary: This gene encodes a protein that is abundantly expressed in cardiac tissue. The encoded protein localizes to intercalated discs in cardiomyocytes and functions as an activator of Rho-dependent serum-response factor signaling. Alternate splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstreamstream gene POLR2M (polymerase (RNA) II (DNA directed) polypeptide M). [provided by RefSeq, Nov 2011]
Mouse(102371) myocardial zonula adherens protein
domestic guinea pig(100717881) myocardial zonula adherens protein
naked mole-rat(101700097) myocardial zonula adherens protein
domestic cat(101088492) myocardial zonula adherens protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209071 MISSION® esiRNA esiRNA targeting mouse Gcom1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092777 predicted 465
2 SASI_Mm01_00092778 predicted 1291
3 SASI_Mm01_00092779 predicted 1311
4 SASI_Mm01_00092780 predicted 1300
5 SASI_Mm01_00092781 predicted 360
6 SASI_Mm01_00092782 predicted 438
7 SASI_Mm01_00092783 predicted 898
8 SASI_Mm02_00288334 predicted 908
9 SASI_Mm01_00092784 predicted 814
10 SASI_Mm01_00092785 predicted 558
11 SASI_Mm01_00092786 predicted 1513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033208
MYZAP MISSION shRNA Bacterial Glycerol Stock
myocardial zonula adherens protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-651s21c1
Sequence:CCGGTAGCCATATCAAGGATCAAATCTCGAGATTTGATCCTTGATATGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-808s21c1
Sequence:CCGGATGCGGGAGATGACGAGAAAGCTCGAGCTTTCTCGTCATCTCCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033208.4-2077s21c1
Sequence:CCGGACCAGCTGAGATCACTATATTCTCGAGAATATAGTGATCTCAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1312s21c1
Sequence:CCGGCAAAGCAGGTTGGACTATTTGCTCGAGCAAATAGTCCAACCTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1405s21c1
Sequence:CCGGACAGGCAGGACTCGTGAAATCCTCGAGGATTTCACGAGTCCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033208
MYZAP MISSION shRNA shRNA Plasmid DNA
myocardial zonula adherens protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-651s21c1
Sequence:CCGGTAGCCATATCAAGGATCAAATCTCGAGATTTGATCCTTGATATGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-808s21c1
Sequence:CCGGATGCGGGAGATGACGAGAAAGCTCGAGCTTTCTCGTCATCTCCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033208.4-2077s21c1
Sequence:CCGGACCAGCTGAGATCACTATATTCTCGAGAATATAGTGATCTCAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1312s21c1
Sequence:CCGGCAAAGCAGGTTGGACTATTTGCTCGAGCAAATAGTCCAACCTGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1405s21c1
Sequence:CCGGACAGGCAGGACTCGTGAAATCCTCGAGGATTTCACGAGTCCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033208
MYZAP MISSION shRNA Lentiviral Transduction Particles
myocardial zonula adherens protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-651s21c1
Sequence:CCGGTAGCCATATCAAGGATCAAATCTCGAGATTTGATCCTTGATATGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-808s21c1
Sequence:CCGGATGCGGGAGATGACGAGAAAGCTCGAGCTTTCTCGTCATCTCCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033208.4-2077s21c1
Sequence:CCGGACCAGCTGAGATCACTATATTCTCGAGAATATAGTGATCTCAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1312s21c1
Sequence:CCGGCAAAGCAGGTTGGACTATTTGCTCGAGCAAATAGTCCAACCTGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033208.4-1405s21c1
Sequence:CCGGACAGGCAGGACTCGTGAAATCCTCGAGGATTTCACGAGTCCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)