EMAIL THIS PAGE TO A FRIEND

MZB1

marginal zone B and B1 cell-specific protein

57 Gene Product Result for
Synonyms: MEDA-7 PACAP pERp1
UniProtKB ID: Q8WU39, D2IYS0, Q7Z6N2, Q96RL5, Q9P0T3
Gene ID:
Mouse(69816) marginal zone B and B1 cell-specific protein 1
Rat(291675) marginal zone B and B1 cell-specific protein
cow(510480) marginal zone B and B1 cell-specific protein
domestic cat(101091341) marginal zone B and B1 cell-specific protein
dog(100688475) marginal zone B and B1 cell-specific protein
sheep(101114700) marginal zone B and B1 cell-specific protein
naked mole-rat(101720508) marginal zone B and B1 cell-specific protein
domestic guinea pig(100730774) marginal zone B and B1 cell-specific protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098211 MISSION® esiRNA esiRNA human AC135457.2-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016459 Rosetta Predictions human pricing
NM_001024240 Rosetta Predictions rat pricing
NM_027222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349498 predicted 356
2 SASI_Hs02_00349499 predicted 433
3 SASI_Hs02_00349500 predicted 302
4 SASI_Hs01_00187398 predicted 478
5 SASI_Hs02_00349501 predicted 299
6 SASI_Hs02_00349502 predicted 318
7 SASI_Hs01_00187400 predicted 602
8 SASI_Hs02_00349503 predicted 303
9 SASI_Hs02_00349504 predicted 314
10 SASI_Hs02_00349505 predicted 420
11 SASI_Hs01_00187396 predicted 699
12 SASI_Hs01_00187397 predicted 558
13 SASI_Hs01_00187399 predicted 694
14 SASI_Hs01_00187401 predicted 712
15 SASI_Hs01_00187402 predicted 552
16 SASI_Hs01_00187403 predicted 687
17 SASI_Hs01_00187404 predicted 548
18 SASI_Hs01_00187405 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089017 predicted 574
2 SASI_Rn01_00089018 predicted 448
3 SASI_Rn01_00089019 predicted 233
4 SASI_Rn01_00089020 predicted 576
5 SASI_Rn01_00089022 predicted 197
6 SASI_Rn01_00089023 predicted 333
7 SASI_Rn02_00202388 predicted 548
8 SASI_Rn01_00089024 predicted 531
9 SASI_Rn01_00089025 predicted 213
10 SASI_Rn01_00089026 predicted 394
11 SASI_Rn01_00089021 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102504 predicted 238
2 SASI_Mm01_00102505 predicted 296
3 SASI_Mm01_00102506 predicted 645
4 SASI_Mm01_00102507 predicted 394
5 SASI_Mm01_00102508 predicted 602
6 SASI_Mm01_00102509 predicted 362
7 SASI_Mm01_00102510 predicted 208
8 SASI_Mm01_00102511 predicted 317
9 SASI_Mm01_00102512 predicted 477
10 SASI_Mm01_00102513 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027222
MZB1 MISSION shRNA Bacterial Glycerol Stock
marginal zone B and B1 cell-specific protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-480s21c1
Sequence:CCGGTTGGAGAGGACCAGATCTATGCTCGAGCATAGATCTGGTCCTCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-352s21c1
Sequence:CCGGGAACCAGATGAAGCGTCTCACCTCGAGGTGAGACGCTTCATCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-443s21c1
Sequence:CCGGAGGCTCTCCAAGACGTGTTTCCTCGAGGAAACACGTCTTGGAGAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027222.1-716s1c1
Sequence:CCGGCCTCGAAAGTGCTGCATTTAACTCGAGTTAAATGCAGCACTTTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-401s1c1
Sequence:CCGGGCCAAGAATCAGCGTGATGATCTCGAGATCATCACGCTGATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-276s1c1
Sequence:CCGGCTGAGTGAATCCACGTACACACTCGAGTGTGTACGTGGATTCACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-231s1c1
Sequence:CCGGGCAGAGGCTAAATCTCACACTCTCGAGAGTGTGAGATTTAGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-123s1c1
Sequence:CCGGGCTCACACACTGGATGATGAACTCGAGTTCATCATCCAGTGTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027222
MZB1 MISSION shRNA shRNA Plasmid DNA
marginal zone B and B1 cell-specific protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-480s21c1
Sequence:CCGGTTGGAGAGGACCAGATCTATGCTCGAGCATAGATCTGGTCCTCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-352s21c1
Sequence:CCGGGAACCAGATGAAGCGTCTCACCTCGAGGTGAGACGCTTCATCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-443s21c1
Sequence:CCGGAGGCTCTCCAAGACGTGTTTCCTCGAGGAAACACGTCTTGGAGAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027222.1-716s1c1
Sequence:CCGGCCTCGAAAGTGCTGCATTTAACTCGAGTTAAATGCAGCACTTTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-401s1c1
Sequence:CCGGGCCAAGAATCAGCGTGATGATCTCGAGATCATCACGCTGATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-276s1c1
Sequence:CCGGCTGAGTGAATCCACGTACACACTCGAGTGTGTACGTGGATTCACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-231s1c1
Sequence:CCGGGCAGAGGCTAAATCTCACACTCTCGAGAGTGTGAGATTTAGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-123s1c1
Sequence:CCGGGCTCACACACTGGATGATGAACTCGAGTTCATCATCCAGTGTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027222
MZB1 MISSION shRNA Lentiviral Transduction Particles
marginal zone B and B1 cell-specific protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-480s21c1
Sequence:CCGGTTGGAGAGGACCAGATCTATGCTCGAGCATAGATCTGGTCCTCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-352s21c1
Sequence:CCGGGAACCAGATGAAGCGTCTCACCTCGAGGTGAGACGCTTCATCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027222.3-443s21c1
Sequence:CCGGAGGCTCTCCAAGACGTGTTTCCTCGAGGAAACACGTCTTGGAGAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027222.1-716s1c1
Sequence:CCGGCCTCGAAAGTGCTGCATTTAACTCGAGTTAAATGCAGCACTTTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-401s1c1
Sequence:CCGGGCCAAGAATCAGCGTGATGATCTCGAGATCATCACGCTGATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-276s1c1
Sequence:CCGGCTGAGTGAATCCACGTACACACTCGAGTGTGTACGTGGATTCACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-231s1c1
Sequence:CCGGGCAGAGGCTAAATCTCACACTCTCGAGAGTGTGAGATTTAGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027222.1-123s1c1
Sequence:CCGGGCTCACACACTGGATGATGAACTCGAGTTCATCATCCAGTGTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016459
MZB1 MISSION shRNA Bacterial Glycerol Stock
marginal zone B and B1 cell-specific protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-361s21c1
Sequence:CCGGGACTACGGAGTTCGAGAAGTGCTCGAGCACTTCTCGAACTCCGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-258s21c1
Sequence:CCGGGGCAGAGACCAAACTTCATACCTCGAGGTATGAAGTTTGGTCTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-221s21c1
Sequence:CCGGGAGCTGTGGCTTACCAGATGTCTCGAGACATCTGGTAAGCCACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166389    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-693s1c1
Sequence:CCGGCAAGAGAAGAGCTCTAGTCCTCTCGAGAGGACTAGAGCTCTTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-560s1c1
Sequence:CCGGCAGGACATGTTTGCACTACTTCTCGAGAAGTAGTGCAAACATGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-584s1c1
Sequence:CCGGGAGTTTGGAGAAGACCAGATCCTCGAGGATCTGGTCTTCTCCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-599s1c1
Sequence:CCGGCAGATCTATGAAGCCCACCAACTCGAGTTGGTGGGCTTCATAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-601s1c1
Sequence:CCGGGATCTATGAAGCCCACCAACACTCGAGTGTTGGTGGGCTTCATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-717s1c1
Sequence:CCGGCTCTACCCTCCTCTGAAAGAACTCGAGTTCTTTCAGAGGAGGGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016459
MZB1 MISSION shRNA shRNA Plasmid DNA
marginal zone B and B1 cell-specific protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-361s21c1
Sequence:CCGGGACTACGGAGTTCGAGAAGTGCTCGAGCACTTCTCGAACTCCGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-258s21c1
Sequence:CCGGGGCAGAGACCAAACTTCATACCTCGAGGTATGAAGTTTGGTCTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-221s21c1
Sequence:CCGGGAGCTGTGGCTTACCAGATGTCTCGAGACATCTGGTAAGCCACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166389    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-693s1c1
Sequence:CCGGCAAGAGAAGAGCTCTAGTCCTCTCGAGAGGACTAGAGCTCTTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-560s1c1
Sequence:CCGGCAGGACATGTTTGCACTACTTCTCGAGAAGTAGTGCAAACATGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-584s1c1
Sequence:CCGGGAGTTTGGAGAAGACCAGATCCTCGAGGATCTGGTCTTCTCCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-599s1c1
Sequence:CCGGCAGATCTATGAAGCCCACCAACTCGAGTTGGTGGGCTTCATAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-601s1c1
Sequence:CCGGGATCTATGAAGCCCACCAACACTCGAGTGTTGGTGGGCTTCATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-717s1c1
Sequence:CCGGCTCTACCCTCCTCTGAAAGAACTCGAGTTCTTTCAGAGGAGGGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016459
MZB1 MISSION shRNA Lentiviral Transduction Particles
marginal zone B and B1 cell-specific protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-361s21c1
Sequence:CCGGGACTACGGAGTTCGAGAAGTGCTCGAGCACTTCTCGAACTCCGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-258s21c1
Sequence:CCGGGGCAGAGACCAAACTTCATACCTCGAGGTATGAAGTTTGGTCTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016459.3-221s21c1
Sequence:CCGGGAGCTGTGGCTTACCAGATGTCTCGAGACATCTGGTAAGCCACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166389    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-693s1c1
Sequence:CCGGCAAGAGAAGAGCTCTAGTCCTCTCGAGAGGACTAGAGCTCTTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-560s1c1
Sequence:CCGGCAGGACATGTTTGCACTACTTCTCGAGAAGTAGTGCAAACATGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-584s1c1
Sequence:CCGGGAGTTTGGAGAAGACCAGATCCTCGAGGATCTGGTCTTCTCCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-599s1c1
Sequence:CCGGCAGATCTATGAAGCCCACCAACTCGAGTTGGTGGGCTTCATAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016459.2-601s1c1
Sequence:CCGGGATCTATGAAGCCCACCAACACTCGAGTGTTGGTGGGCTTCATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016459.2-717s1c1
Sequence:CCGGCTCTACCCTCCTCTGAAAGAACTCGAGTTCTTTCAGAGGAGGGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)