EMAIL THIS PAGE TO A FRIEND

MZF1

myeloid zinc finger 1

56 Gene Product Result for
Synonyms: MZF-1 MZF1B ZFP98 ZNF42 ZSCAN6
UniProtKB ID: P28698, M0QXU0, Q7Z729, Q96I71, Q9NRY0, Q9UBW2
Gene ID:
Mouse(109889) myeloid zinc finger 1
Rat(361508) myeloid zinc finger 1
domestic guinea pig(100716713) myeloid zinc finger 1
cow(523865) myeloid zinc finger 1
Horse(100064908) myeloid zinc finger 1
domestic cat(101085675) myeloid zinc finger 1
dog(484220) myeloid zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151161 MISSION® esiRNA esiRNA human MZF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003422 Rosetta Predictions human pricing
NM_198055 Rosetta Predictions human pricing
NM_001108470 Rosetta Predictions rat pricing
NM_145819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096724 predicted 2061
2 SASI_Hs01_00096725 predicted 2003
3 SASI_Hs01_00096726 predicted 742
4 SASI_Hs01_00096728 predicted 1753
5 SASI_Hs01_00096729 predicted 1565
6 SASI_Hs01_00096730 predicted 1346
7 SASI_Hs01_00096731 predicted 1160
8 SASI_Hs01_00096732 predicted 1310
9 SASI_Hs01_00096733 predicted 1387
10 SASI_Hs02_00335633 predicted 840
11 SASI_Hs01_00096727 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192955 predicted 2380
2 SASI_Hs01_00192956 predicted 2327
3 SASI_Hs01_00192957 predicted 1052
4 SASI_Hs01_00192959 predicted 2069
5 SASI_Hs01_00192960 predicted 1881
6 SASI_Hs01_00192961 predicted 1665
7 SASI_Hs01_00192962 predicted 1483
8 SASI_Hs01_00192963 predicted 1625
9 SASI_Hs01_00192964 predicted 1701
10 SASI_Hs02_00371610 predicted 1157
11 SASI_Hs01_00192958 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238959 predicted 843
2 SASI_Rn02_00238960 predicted 2747
3 SASI_Rn02_00238961 predicted 997
4 SASI_Rn02_00238962 predicted 637
5 SASI_Rn02_00238963 predicted 2356
6 SASI_Rn02_00238964 predicted 901
7 SASI_Rn02_00238965 predicted 1965
8 SASI_Rn02_00238966 predicted 1575
9 SASI_Rn02_00238967 predicted 2350
10 SASI_Rn02_00238968 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038072 predicted 1372
2 SASI_Mm01_00038073 predicted 1119
3 SASI_Mm01_00038074 predicted 368
4 SASI_Mm01_00038075 predicted 2047
5 SASI_Mm01_00038076 predicted 1321
6 SASI_Mm01_00038077 predicted 2258
7 SASI_Mm01_00038078 predicted 1449
8 SASI_Mm01_00038079 predicted 1938
9 SASI_Mm01_00038080 predicted 340
10 SASI_Mm01_00038081 predicted 2102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145819
MZF1 MISSION shRNA Bacterial Glycerol Stock
myeloid zinc finger 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145819.2-2759s21c1
Sequence:CCGGCTGCTTTCTTGTGGGATATACCTCGAGGTATATCCCACAAGAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-543s21c1
Sequence:CCGGGCTACGCCCAGAAGTACATTCCTCGAGGAATGTACTTCTGGGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-701s21c1
Sequence:CCGGAGCTTGATGGACCTCGGAAATCTCGAGATTTCCGAGGTCCATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1184s21c1
Sequence:CCGGCTAGCCTCTCTGGACAGATACCTCGAGGTATCTGTCCAGAGAGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1125s21c1
Sequence:CCGGCACGGCAGAGCCAGATATGATCTCGAGATCATATCTGGCTCTGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-476s21c1
Sequence:CCGGTCCGGTATGAGGATGCAATAGCTCGAGCTATTGCATCCTCATACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-409s21c1
Sequence:CCGGGACGATGAGAGAGAAGATATACTCGAGTATATCTTCTCTCTCATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145819
MZF1 MISSION shRNA shRNA Plasmid DNA
myeloid zinc finger 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145819.2-2759s21c1
Sequence:CCGGCTGCTTTCTTGTGGGATATACCTCGAGGTATATCCCACAAGAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-543s21c1
Sequence:CCGGGCTACGCCCAGAAGTACATTCCTCGAGGAATGTACTTCTGGGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-701s21c1
Sequence:CCGGAGCTTGATGGACCTCGGAAATCTCGAGATTTCCGAGGTCCATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1184s21c1
Sequence:CCGGCTAGCCTCTCTGGACAGATACCTCGAGGTATCTGTCCAGAGAGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1125s21c1
Sequence:CCGGCACGGCAGAGCCAGATATGATCTCGAGATCATATCTGGCTCTGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-476s21c1
Sequence:CCGGTCCGGTATGAGGATGCAATAGCTCGAGCTATTGCATCCTCATACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-409s21c1
Sequence:CCGGGACGATGAGAGAGAAGATATACTCGAGTATATCTTCTCTCTCATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145819
MZF1 MISSION shRNA Lentiviral Transduction Particles
myeloid zinc finger 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145819.2-2759s21c1
Sequence:CCGGCTGCTTTCTTGTGGGATATACCTCGAGGTATATCCCACAAGAAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-543s21c1
Sequence:CCGGGCTACGCCCAGAAGTACATTCCTCGAGGAATGTACTTCTGGGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-701s21c1
Sequence:CCGGAGCTTGATGGACCTCGGAAATCTCGAGATTTCCGAGGTCCATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1184s21c1
Sequence:CCGGCTAGCCTCTCTGGACAGATACCTCGAGGTATCTGTCCAGAGAGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-1125s21c1
Sequence:CCGGCACGGCAGAGCCAGATATGATCTCGAGATCATATCTGGCTCTGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-476s21c1
Sequence:CCGGTCCGGTATGAGGATGCAATAGCTCGAGCTATTGCATCCTCATACCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145819.2-409s21c1
Sequence:CCGGGACGATGAGAGAGAAGATATACTCGAGTATATCTTCTCTCTCATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003422
MZF1 MISSION shRNA Bacterial Glycerol Stock
myeloid zinc finger 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-2399s21c1
Sequence:CCGGACCAGAGCACCAAGCTCATTCCTCGAGGAATGAGCTTGGTGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-904s21c1
Sequence:CCGGACCGTGCTGGACCAGATCTTTCTCGAGAAAGATCTGGTCCAGCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-808s21c1
Sequence:CCGGGTTACAGAGGACTCAGATTTCCTCGAGGAAATCTGAGTCCTCTGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003422.2-2467s1c1
Sequence:CCGGGTGTCCGCCATGGTCAGAACACTCGAGTGTTCTGACCATGGCGGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1311s1c1
Sequence:CCGGCCGTTGCGATGTATGTGGCAACTCGAGTTGCCACATACATCGCAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-2397s1c1
Sequence:CCGGCCACCAGAGCACCAAGCTCATCTCGAGATGAGCTTGGTGCTCTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1043s1c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-806s1c1
Sequence:CCGGAGGTTACAGAGGACTCAGATTCTCGAGAATCTGAGTCCTCTGTAACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-1043s21c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-381s21c1
Sequence:CCGGTTTCCGGTGCTTCCGCTATGACTCGAGTCATAGCGGAAGCACCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003422
MZF1 MISSION shRNA shRNA Plasmid DNA
myeloid zinc finger 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-2399s21c1
Sequence:CCGGACCAGAGCACCAAGCTCATTCCTCGAGGAATGAGCTTGGTGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-904s21c1
Sequence:CCGGACCGTGCTGGACCAGATCTTTCTCGAGAAAGATCTGGTCCAGCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-808s21c1
Sequence:CCGGGTTACAGAGGACTCAGATTTCCTCGAGGAAATCTGAGTCCTCTGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003422.2-2467s1c1
Sequence:CCGGGTGTCCGCCATGGTCAGAACACTCGAGTGTTCTGACCATGGCGGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1311s1c1
Sequence:CCGGCCGTTGCGATGTATGTGGCAACTCGAGTTGCCACATACATCGCAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-2397s1c1
Sequence:CCGGCCACCAGAGCACCAAGCTCATCTCGAGATGAGCTTGGTGCTCTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1043s1c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-806s1c1
Sequence:CCGGAGGTTACAGAGGACTCAGATTCTCGAGAATCTGAGTCCTCTGTAACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-1043s21c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-381s21c1
Sequence:CCGGTTTCCGGTGCTTCCGCTATGACTCGAGTCATAGCGGAAGCACCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003422
MZF1 MISSION shRNA Lentiviral Transduction Particles
myeloid zinc finger 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-2399s21c1
Sequence:CCGGACCAGAGCACCAAGCTCATTCCTCGAGGAATGAGCTTGGTGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-904s21c1
Sequence:CCGGACCGTGCTGGACCAGATCTTTCTCGAGAAAGATCTGGTCCAGCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-808s21c1
Sequence:CCGGGTTACAGAGGACTCAGATTTCCTCGAGGAAATCTGAGTCCTCTGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003422.2-2467s1c1
Sequence:CCGGGTGTCCGCCATGGTCAGAACACTCGAGTGTTCTGACCATGGCGGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1311s1c1
Sequence:CCGGCCGTTGCGATGTATGTGGCAACTCGAGTTGCCACATACATCGCAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-2397s1c1
Sequence:CCGGCCACCAGAGCACCAAGCTCATCTCGAGATGAGCTTGGTGCTCTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-1043s1c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003422.2-806s1c1
Sequence:CCGGAGGTTACAGAGGACTCAGATTCTCGAGAATCTGAGTCCTCTGTAACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-1043s21c1
Sequence:CCGGCCGCAGGTCCAGGTAGTGTAACTCGAGTTACACTACCTGGACCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003422.2-381s21c1
Sequence:CCGGTTTCCGGTGCTTCCGCTATGACTCGAGTCATAGCGGAAGCACCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016793
MZF1 MISSION shRNA Bacterial Glycerol Stock
myeloid zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-482s1c1
Sequence:CCGGCCTTGTACTATTCCTTCCCTACTCGAGTAGGGAAGGAATAGTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-1078s1c1
Sequence:CCGGCCACTGAACCTACCAATGAAACTCGAGTTTCATTGGTAGGTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-896s1c1
Sequence:CCGGCCTTGGTTGACAGACTTCGATCTCGAGATCGAAGTCTGTCAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-693s1c1
Sequence:CCGGCTTCCGGTATGAGGATGCAATCTCGAGATTGCATCCTCATACCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-2384s1c1
Sequence:CCGGCGCGCCACCAAAGGACCCATACTCGAGTATGGGTCCTTTGGTGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016793
MZF1 MISSION shRNA shRNA Plasmid DNA
myeloid zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-482s1c1
Sequence:CCGGCCTTGTACTATTCCTTCCCTACTCGAGTAGGGAAGGAATAGTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-1078s1c1
Sequence:CCGGCCACTGAACCTACCAATGAAACTCGAGTTTCATTGGTAGGTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-896s1c1
Sequence:CCGGCCTTGGTTGACAGACTTCGATCTCGAGATCGAAGTCTGTCAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-693s1c1
Sequence:CCGGCTTCCGGTATGAGGATGCAATCTCGAGATTGCATCCTCATACCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-2384s1c1
Sequence:CCGGCGCGCCACCAAAGGACCCATACTCGAGTATGGGTCCTTTGGTGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016793
MZF1 MISSION shRNA Lentiviral Transduction Particles
myeloid zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-482s1c1
Sequence:CCGGCCTTGTACTATTCCTTCCCTACTCGAGTAGGGAAGGAATAGTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-1078s1c1
Sequence:CCGGCCACTGAACCTACCAATGAAACTCGAGTTTCATTGGTAGGTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-896s1c1
Sequence:CCGGCCTTGGTTGACAGACTTCGATCTCGAGATCGAAGTCTGTCAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-693s1c1
Sequence:CCGGCTTCCGGTATGAGGATGCAATCTCGAGATTGCATCCTCATACCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016793.1-2384s1c1
Sequence:CCGGCGCGCCACCAAAGGACCCATACTCGAGTATGGGTCCTTTGGTGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)