EMAIL THIS PAGE TO A FRIEND

MZT2A

mitotic spindle organizing protein 2A

18 Gene Product Result for
Synonyms: FAM128A MOZART2A
Species: Human MZT2A(653784)
UniProtKB ID: Q6P582, Q3SWV8, Q8WVB2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052623 Anti-MZT2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085365 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085365 Rosetta Predictions human pricing
XM_929797 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317482 predicted 590
2 SASI_Hs02_00317483 predicted 483
3 SASI_Hs02_00317484 predicted 563
4 SASI_Hs02_00317485 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260387 predicted 372
2 SASI_Hs01_00260388 predicted 370
3 SASI_Hs01_00260389 predicted 399
4 SASI_Hs01_00260390 predicted 257
5 SASI_Hs01_00260391 predicted 462
6 SASI_Hs01_00260392 predicted 258
7 SASI_Hs01_00260393 predicted 372
8 SASI_Hs01_00260394 predicted 438
9 SASI_Hs01_00260395 predicted 449
10 SASI_Hs01_00260396 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085365
MZT2A MISSION shRNA Bacterial Glycerol Stock
mitotic spindle organizing protein 2A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-218s21c1
Sequence:CCGGACCGAGGAGATGGAGCTGTACCTCGAGGTACAGCTCCATCTCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-338s21c1
Sequence:CCGGATGCTCAAGTCCATGTGTGCCCTCGAGGGCACACATGGACTTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-275s21c1
Sequence:CCGGGACGTGTTCAAGATCCTGGTGCTCGAGCACCAGGATCTTGAACACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-426s21c1
Sequence:CCGGAGACCCGAGGGAGAGACAAAGCTCGAGCTTTGTCTCTCCCTCGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-327s21c1
Sequence:CCGGCCGTCTTCCAGATGCTCAAGTCTCGAGACTTGAGCATCTGGAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085365
MZT2A MISSION shRNA shRNA Plasmid DNA
mitotic spindle organizing protein 2A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-218s21c1
Sequence:CCGGACCGAGGAGATGGAGCTGTACCTCGAGGTACAGCTCCATCTCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-338s21c1
Sequence:CCGGATGCTCAAGTCCATGTGTGCCCTCGAGGGCACACATGGACTTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-275s21c1
Sequence:CCGGGACGTGTTCAAGATCCTGGTGCTCGAGCACCAGGATCTTGAACACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-426s21c1
Sequence:CCGGAGACCCGAGGGAGAGACAAAGCTCGAGCTTTGTCTCTCCCTCGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-327s21c1
Sequence:CCGGCCGTCTTCCAGATGCTCAAGTCTCGAGACTTGAGCATCTGGAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085365
MZT2A MISSION shRNA Lentiviral Transduction Particles
mitotic spindle organizing protein 2A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-218s21c1
Sequence:CCGGACCGAGGAGATGGAGCTGTACCTCGAGGTACAGCTCCATCTCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-338s21c1
Sequence:CCGGATGCTCAAGTCCATGTGTGCCCTCGAGGGCACACATGGACTTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-275s21c1
Sequence:CCGGGACGTGTTCAAGATCCTGGTGCTCGAGCACCAGGATCTTGAACACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-426s21c1
Sequence:CCGGAGACCCGAGGGAGAGACAAAGCTCGAGCTTTGTCTCTCCCTCGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085365.1-327s21c1
Sequence:CCGGCCGTCTTCCAGATGCTCAAGTCTCGAGACTTGAGCATCTGGAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)