EMAIL THIS PAGE TO A FRIEND

N4BP1

NEDD4 binding protein 1

180 Gene Product Result for
UniProtKB ID: O75113, A7MD49, Q2YDX1
Gene ID:
Mouse(80750) NEDD4 binding protein 1
Rat(291921) Nedd4 binding protein 1
sheep(101115818) NEDD4 binding protein 1
domestic guinea pig(100714571) NEDD4 binding protein 1
naked mole-rat(101703278) NEDD4 binding protein 1
Domestic Rabbit(100358915) NEDD4 binding protein 1
Zebrafish(327327) nedd4 binding protein 1
dog(478135) NEDD4 binding protein 1
Horse(100057787) NEDD4 binding protein 1
cow(540948) NEDD4 binding protein 1
domestic cat(101090731) NEDD4 binding protein 1
chicken(415739) NEDD4 binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153029 Rosetta Predictions human pricing
XM_001068071 Rosetta Predictions rat pricing
XM_214648 Rosetta Predictions rat pricing
XM_894155 Rosetta Predictions mouse pricing
XM_988455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101757 predicted 1935
2 SASI_Hs01_00101760 predicted 1364
3 SASI_Hs01_00101761 predicted 2513
4 SASI_Hs01_00101762 predicted 2352
5 SASI_Hs01_00101763 predicted 901
6 SASI_Hs01_00101764 predicted 1488
7 SASI_Hs01_00101765 predicted 745
8 SASI_Hs02_00366986 predicted 1168
9 SASI_Hs01_00101766 predicted 1671
10 SASI_Hs02_00366987 predicted 980
11 SASI_Hs01_00101758 predicted 2165
12 SASI_Hs01_00101759 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323324 predicted 589
2 SASI_Rn02_00323325 predicted 1969
3 SASI_Rn02_00323326 predicted 599
4 SASI_Rn02_00323327 predicted 801
5 SASI_Rn02_00323328 predicted 1981
6 SASI_Rn02_00323329 predicted 430
7 SASI_Rn02_00323330 predicted 1478
8 SASI_Rn02_00323331 predicted 809
9 SASI_Rn02_00323332 predicted 1874
10 SASI_Rn02_00323333 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375475 predicted 587
2 SASI_Rn02_00375476 predicted 1969
3 SASI_Rn02_00375477 predicted 1431
4 SASI_Rn02_00375478 predicted 604
5 SASI_Rn02_00375479 predicted 794
6 SASI_Rn02_00375480 predicted 1975
7 SASI_Rn02_00375481 predicted 427
8 SASI_Rn02_00375482 predicted 1480
9 SASI_Rn02_00375483 predicted 812
10 SASI_Rn02_00375484 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237160 predicted 1782
2 SASI_Mm02_00429429 predicted 2641
3 SASI_Mm01_00237162 predicted 1758
4 SASI_Mm02_00429430 predicted 1132
5 SASI_Mm01_00237163 predicted 1975
6 SASI_Mm01_00237164 predicted 2946
7 SASI_Mm01_00237165 predicted 3409
8 SASI_Mm01_00237166 predicted 2579
9 SASI_Mm01_00237167 predicted 1333
10 SASI_Mm01_00237168 predicted 1345
11 SASI_Mm01_00237161 predicted 2007
12 SASI_Mm01_00237169 predicted 2442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449648 predicted 1778
2 SASI_Mm02_00449649 predicted 2639
3 SASI_Mm02_00449650 predicted 1756
4 SASI_Mm02_00449651 predicted 1133
5 SASI_Mm02_00449652 predicted 1970
6 SASI_Mm02_00449653 predicted 2951
7 SASI_Mm02_00449654 predicted 3416
8 SASI_Mm02_00449655 predicted 2573
9 SASI_Mm02_00449656 predicted 1333
10 SASI_Mm02_00449657 predicted 1344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030563
VALIDATED
N4BP1 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-1561s21c1
Sequence:CCGGTCTCGCAGTTACCGTTCAAAGCTCGAGCTTTGAACGGTAACTGCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-3167s21c1
Sequence:CCGGAGTTACTCTTGAGTGTATTTACTCGAGTAAATACACTCAAGAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030563.2-425s21c1
Sequence:CCGGGCACAGCGCCAAGGAGTATATCTCGAGATATACTCCTTGGCGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2159s21c1
Sequence:CCGGAGCAATTGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2074s21c1
Sequence:CCGGGAGCAGATTTGAAGCATATTGCTCGAGCAATATGCTTCAAATCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030563
VALIDATED
N4BP1 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-1561s21c1
Sequence:CCGGTCTCGCAGTTACCGTTCAAAGCTCGAGCTTTGAACGGTAACTGCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-3167s21c1
Sequence:CCGGAGTTACTCTTGAGTGTATTTACTCGAGTAAATACACTCAAGAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030563.2-425s21c1
Sequence:CCGGGCACAGCGCCAAGGAGTATATCTCGAGATATACTCCTTGGCGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2159s21c1
Sequence:CCGGAGCAATTGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2074s21c1
Sequence:CCGGGAGCAGATTTGAAGCATATTGCTCGAGCAATATGCTTCAAATCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030563
VALIDATED
N4BP1 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-1561s21c1
Sequence:CCGGTCTCGCAGTTACCGTTCAAAGCTCGAGCTTTGAACGGTAACTGCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-3167s21c1
Sequence:CCGGAGTTACTCTTGAGTGTATTTACTCGAGTAAATACACTCAAGAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030563.2-425s21c1
Sequence:CCGGGCACAGCGCCAAGGAGTATATCTCGAGATATACTCCTTGGCGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2159s21c1
Sequence:CCGGAGCAATTGCAGTTGAGTATTTCTCGAGAAATACTCAACTGCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030563.2-2074s21c1
Sequence:CCGGGAGCAGATTTGAAGCATATTGCTCGAGCAATATGCTTCAAATCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153029
VALIDATED
N4BP1 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153029.3-2277s21c1
Sequence:CCGGGCTCCAGGAGCTCGGAATATTCTCGAGAATATTCCGAGCTCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-3925s1c1
Sequence:CCGGCCCAAGCCAATAAATAGCATTCTCGAGAATGCTATTTATTGGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1352s1c1
Sequence:CCGGGACCATCTACTGAACCATTATCTCGAGATAATGGTTCAGTAGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1174s1c1
Sequence:CCGGGCTAAGACATTGGCTGGAAATCTCGAGATTTCCAGCCAATGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3191s21c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3167s21c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-1484s1c1
Sequence:CCGGGCAGCACAAATGAGCTTACAACTCGAGTTGTAAGCTCATTTGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-2195s1c1
Sequence:CCGGGCAACAGAAACATCACTGTATCTCGAGATACAGTGATGTTTCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-1976s21c1
Sequence:CCGGCAGGACCTTCTGATCATATTGCTCGAGCAATATGATCAGAAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-2239s21c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153029
VALIDATED
N4BP1 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153029.3-2277s21c1
Sequence:CCGGGCTCCAGGAGCTCGGAATATTCTCGAGAATATTCCGAGCTCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-3925s1c1
Sequence:CCGGCCCAAGCCAATAAATAGCATTCTCGAGAATGCTATTTATTGGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1352s1c1
Sequence:CCGGGACCATCTACTGAACCATTATCTCGAGATAATGGTTCAGTAGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1174s1c1
Sequence:CCGGGCTAAGACATTGGCTGGAAATCTCGAGATTTCCAGCCAATGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3191s21c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3167s21c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-1484s1c1
Sequence:CCGGGCAGCACAAATGAGCTTACAACTCGAGTTGTAAGCTCATTTGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-2195s1c1
Sequence:CCGGGCAACAGAAACATCACTGTATCTCGAGATACAGTGATGTTTCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-1976s21c1
Sequence:CCGGCAGGACCTTCTGATCATATTGCTCGAGCAATATGATCAGAAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-2239s21c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153029
VALIDATED
N4BP1 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153029.3-2277s21c1
Sequence:CCGGGCTCCAGGAGCTCGGAATATTCTCGAGAATATTCCGAGCTCCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-3925s1c1
Sequence:CCGGCCCAAGCCAATAAATAGCATTCTCGAGAATGCTATTTATTGGCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1352s1c1
Sequence:CCGGGACCATCTACTGAACCATTATCTCGAGATAATGGTTCAGTAGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153029.3-1174s1c1
Sequence:CCGGGCTAAGACATTGGCTGGAAATCTCGAGATTTCCAGCCAATGTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3191s21c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-3167s21c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-1484s1c1
Sequence:CCGGGCAGCACAAATGAGCTTACAACTCGAGTTGTAAGCTCATTTGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153029.3-2195s1c1
Sequence:CCGGGCAACAGAAACATCACTGTATCTCGAGATACAGTGATGTTTCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-1976s21c1
Sequence:CCGGCAGGACCTTCTGATCATATTGCTCGAGCAATATGATCAGAAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_153029.3-2239s21c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375355
VALIDATED
N4BP1 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000128563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3191s1c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-517s1c1
Sequence:CCGGGCAGAGAGCCTGTTTCTGAAACTCGAGTTTCAGAAACAGGCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3167s1c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-2239s1c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375355
VALIDATED
N4BP1 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000128563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3191s1c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-517s1c1
Sequence:CCGGGCAGAGAGCCTGTTTCTGAAACTCGAGTTTCAGAAACAGGCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3167s1c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-2239s1c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375355
VALIDATED
N4BP1 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000128563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3191s1c1
Sequence:CCGGGCAGTTACTCTTGAGTGTATTCTCGAGAATACACTCAAGAGTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-517s1c1
Sequence:CCGGGCAGAGAGCCTGTTTCTGAAACTCGAGTTTCAGAAACAGGCTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-3167s1c1
Sequence:CCGGCTGCCTGTTCAGAACTGTTTACTCGAGTAAACAGTTCTGAACAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_375355.1-2239s1c1
Sequence:CCGGCGTGATCCTAATGTCACAGAACTCGAGTTCTGTGACATTAGGATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)