EMAIL THIS PAGE TO A FRIEND

N4BP2

NEDD4 binding protein 2

60 Gene Product Result for
Synonyms: B3BP
UniProtKB ID: Q86UW6, A0AVR3, Q9NVK2, Q9P2D4
Gene ID:
Human(55728) Summary: This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. [provided by RefSeq, Jul 2008]
Mouse(333789) NEDD4 binding protein 2
Rat(305342) NEDD4 binding protein 2
Zebrafish(558048) NEDD4 binding protein 2
cow(539533) NEDD4 binding protein 2
Horse(100063898) NEDD4 binding protein 2
domestic cat(101094097) NEDD4 binding protein 2
dog(479101) NEDD4 binding protein 2
chicken(422786) NEDD4 binding protein 2
Domestic Rabbit(100353080) NEDD4 binding protein 2
naked mole-rat(101705775) NEDD4 binding protein 2
domestic guinea pig(100716922) NEDD4 binding protein 2
sheep(101115369) NEDD4 binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018177 Rosetta Predictions human pricing
XM_001077973 Rosetta Predictions rat pricing
XM_223405 Rosetta Predictions rat pricing
NM_001024917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025647 predicted 4168
2 SASI_Hs02_00351430 predicted 1049
3 SASI_Hs01_00025648 predicted 1856
4 SASI_Hs01_00025649 predicted 2494
5 SASI_Hs01_00025650 predicted 4682
6 SASI_Hs02_00351431 predicted 4438
7 SASI_Hs01_00025651 predicted 4103
8 SASI_Hs01_00025653 predicted 2864
9 SASI_Hs01_00025655 predicted 1984
10 SASI_Hs01_00025656 predicted 1200
11 SASI_Hs01_00025652 predicted 1437
12 SASI_Hs01_00025654 predicted 4579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359161 predicted 2544
2 SASI_Rn02_00359162 predicted 3673
3 SASI_Rn02_00359163 predicted 1792
4 SASI_Rn02_00359164 predicted 4037
5 SASI_Rn02_00359165 predicted 4320
6 SASI_Rn02_00359166 predicted 2533
7 SASI_Rn02_00359167 predicted 1089
8 SASI_Rn02_00359168 predicted 4700
9 SASI_Rn02_00359169 predicted 861
10 SASI_Rn02_00359170 predicted 2346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381345 predicted 2543
2 SASI_Rn02_00381346 predicted 1794
3 SASI_Rn02_00381347 predicted 4311
4 SASI_Rn02_00381348 predicted 2531
5 SASI_Rn02_00381349 predicted 1084
6 SASI_Rn02_00381350 predicted 1817
7 SASI_Rn02_00381351 predicted 4701
8 SASI_Rn02_00381352 predicted 858
9 SASI_Rn02_00381353 predicted 1456
10 SASI_Rn02_00381354 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060160 predicted 3394
2 SASI_Mm01_00060161 predicted 5503
3 SASI_Mm01_00060162 predicted 4363
4 SASI_Mm02_00287737 predicted 4556
5 SASI_Mm01_00060163 predicted 2104
6 SASI_Mm01_00060164 predicted 1746
7 SASI_Mm01_00060165 predicted 3607
8 SASI_Mm01_00060167 predicted 4600
9 SASI_Mm02_00287738 predicted 1213
10 SASI_Mm01_00060168 predicted 1829
11 SASI_Mm01_00060166 predicted 3541
12 SASI_Mm01_00060169 predicted 2248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018177
VALIDATED
N4BP2 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-810s21c1
Sequence:CCGGGATGACCAAGTATACTCATTTCTCGAGAAATGAGTATACTTGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3874s21c1
Sequence:CCGGTTAGCCATGGGATTGGTATTACTCGAGTAATACCAATCCCATGGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3979s21c1
Sequence:CCGGATGAATCGATGACAAGTATATCTCGAGATATACTTGTCATCGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-5365s1c1
Sequence:CCGGGCTGTCATTAAGTACCTCATACTCGAGTATGAGGTACTTAATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-555s1c1
Sequence:CCGGCCTGGATTCCTTAATACAGAACTCGAGTTCTGTATTAAGGAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-1606s1c1
Sequence:CCGGGCACATGAATGGAACCAGAATCTCGAGATTCTGGTTCCATTCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-2715s1c1
Sequence:CCGGGCCACTCAATAGCTATAAATACTCGAGTATTTATAGCTATTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-1069s1c1
Sequence:CCGGCGGGTCTCTGATGTGTTTCTACTCGAGTAGAAACACATCAGAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018177
VALIDATED
N4BP2 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-810s21c1
Sequence:CCGGGATGACCAAGTATACTCATTTCTCGAGAAATGAGTATACTTGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3874s21c1
Sequence:CCGGTTAGCCATGGGATTGGTATTACTCGAGTAATACCAATCCCATGGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3979s21c1
Sequence:CCGGATGAATCGATGACAAGTATATCTCGAGATATACTTGTCATCGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-5365s1c1
Sequence:CCGGGCTGTCATTAAGTACCTCATACTCGAGTATGAGGTACTTAATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-555s1c1
Sequence:CCGGCCTGGATTCCTTAATACAGAACTCGAGTTCTGTATTAAGGAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-1606s1c1
Sequence:CCGGGCACATGAATGGAACCAGAATCTCGAGATTCTGGTTCCATTCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-2715s1c1
Sequence:CCGGGCCACTCAATAGCTATAAATACTCGAGTATTTATAGCTATTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-1069s1c1
Sequence:CCGGCGGGTCTCTGATGTGTTTCTACTCGAGTAGAAACACATCAGAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018177
VALIDATED
N4BP2 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-810s21c1
Sequence:CCGGGATGACCAAGTATACTCATTTCTCGAGAAATGAGTATACTTGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3874s21c1
Sequence:CCGGTTAGCCATGGGATTGGTATTACTCGAGTAATACCAATCCCATGGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018177.3-3979s21c1
Sequence:CCGGATGAATCGATGACAAGTATATCTCGAGATATACTTGTCATCGATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-5365s1c1
Sequence:CCGGGCTGTCATTAAGTACCTCATACTCGAGTATGAGGTACTTAATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-555s1c1
Sequence:CCGGCCTGGATTCCTTAATACAGAACTCGAGTTCTGTATTAAGGAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018177.2-1606s1c1
Sequence:CCGGGCACATGAATGGAACCAGAATCTCGAGATTCTGGTTCCATTCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-2715s1c1
Sequence:CCGGGCCACTCAATAGCTATAAATACTCGAGTATTTATAGCTATTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018177.2-1069s1c1
Sequence:CCGGCGGGTCTCTGATGTGTTTCTACTCGAGTAGAAACACATCAGAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024917
VALIDATED
N4BP2 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1744s1c1
Sequence:CCGGCTGATGACTACTTCTATATAACTCGAGTTATATAGAAGTAGTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1855s1c1
Sequence:CCGGCTCCAGTAATCATAGATAATACTCGAGTATTATCTATGATTACTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1717s21c1
Sequence:CCGGATAACCCAGGTGGCGTCATTCCTCGAGGAATGACGCCACCTGGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1982s21c1
Sequence:CCGGGGAGCTTGCGAGACGTAATATCTCGAGATATTACGTCTCGCAAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-842s21c1
Sequence:CCGGTAACGACCCTTCCACCTTTATCTCGAGATAAAGGTGGAAGGGTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1762s21c1
Sequence:CCGGTAAACGGACAGTACCAGTTTGCTCGAGCAAACTGGTACTGTCCGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1079s21c1
Sequence:CCGGTGTTAGAGGTTGTGGCAATTTCTCGAGAAATTGCCACAACCTCTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2788s1c1
Sequence:CCGGCCCACAAAGTATTAGATGCTACTCGAGTAGCATCTAATACTTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-853s1c1
Sequence:CCGGCCACCTTTATGAACTCAGATTCTCGAGAATCTGAGTTCATAAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2250s1c1
Sequence:CCGGGCAGTGTTATCTGTGCGTGATCTCGAGATCACGCACAGATAACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024917
VALIDATED
N4BP2 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1744s1c1
Sequence:CCGGCTGATGACTACTTCTATATAACTCGAGTTATATAGAAGTAGTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1855s1c1
Sequence:CCGGCTCCAGTAATCATAGATAATACTCGAGTATTATCTATGATTACTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1717s21c1
Sequence:CCGGATAACCCAGGTGGCGTCATTCCTCGAGGAATGACGCCACCTGGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1982s21c1
Sequence:CCGGGGAGCTTGCGAGACGTAATATCTCGAGATATTACGTCTCGCAAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-842s21c1
Sequence:CCGGTAACGACCCTTCCACCTTTATCTCGAGATAAAGGTGGAAGGGTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1762s21c1
Sequence:CCGGTAAACGGACAGTACCAGTTTGCTCGAGCAAACTGGTACTGTCCGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1079s21c1
Sequence:CCGGTGTTAGAGGTTGTGGCAATTTCTCGAGAAATTGCCACAACCTCTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2788s1c1
Sequence:CCGGCCCACAAAGTATTAGATGCTACTCGAGTAGCATCTAATACTTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-853s1c1
Sequence:CCGGCCACCTTTATGAACTCAGATTCTCGAGAATCTGAGTTCATAAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2250s1c1
Sequence:CCGGGCAGTGTTATCTGTGCGTGATCTCGAGATCACGCACAGATAACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024917
VALIDATED
N4BP2 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1744s1c1
Sequence:CCGGCTGATGACTACTTCTATATAACTCGAGTTATATAGAAGTAGTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-1855s1c1
Sequence:CCGGCTCCAGTAATCATAGATAATACTCGAGTATTATCTATGATTACTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1717s21c1
Sequence:CCGGATAACCCAGGTGGCGTCATTCCTCGAGGAATGACGCCACCTGGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1982s21c1
Sequence:CCGGGGAGCTTGCGAGACGTAATATCTCGAGATATTACGTCTCGCAAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-842s21c1
Sequence:CCGGTAACGACCCTTCCACCTTTATCTCGAGATAAAGGTGGAAGGGTCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024917.1-1762s21c1
Sequence:CCGGTAAACGGACAGTACCAGTTTGCTCGAGCAAACTGGTACTGTCCGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024917.1-1079s21c1
Sequence:CCGGTGTTAGAGGTTGTGGCAATTTCTCGAGAAATTGCCACAACCTCTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2788s1c1
Sequence:CCGGCCCACAAAGTATTAGATGCTACTCGAGTAGCATCTAATACTTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-853s1c1
Sequence:CCGGCCACCTTTATGAACTCAGATTCTCGAGAATCTGAGTTCATAAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024917.1-2250s1c1
Sequence:CCGGGCAGTGTTATCTGTGCGTGATCTCGAGATCACGCACAGATAACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)