EMAIL THIS PAGE TO A FRIEND

N4BP2L1

NEDD4 binding protein 2-like 1

130 Gene Product Result for
Synonyms: CG018
UniProtKB ID: Q5TBK1, A4QN21, Q5TBK0
Gene ID:
Mouse(100637) NEDD4 binding protein 2-like 1
Rat(498131) NEDD4 binding protein 2-like 1
sheep(101109715) NEDD4 binding protein 2-like 1
domestic guinea pig(100723766) NEDD4 binding protein 2-like 1
naked mole-rat(101696292) NEDD4 binding protein 2-like 1
chicken(418914) NEDD4 binding protein 2-like 1
cow(616069) NEDD4 binding protein 2-like 1
domestic cat(101080502) NEDD4 binding protein 2-like 1
dog(607846) NEDD4 binding protein 2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052818 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079691 Rosetta Predictions human pricing
NM_052818 Rosetta Predictions human pricing
NM_001035222 Rosetta Predictions rat pricing
XM_001062707 Rosetta Predictions rat pricing
XM_001070954 Rosetta Predictions rat pricing
NM_133898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313690 predicted 792
2 SASI_Hs02_00313691 predicted 827
3 SASI_Hs02_00313692 predicted 798
4 SASI_Hs02_00313693 predicted 809
5 SASI_Hs02_00313694 predicted 984
6 SASI_Hs02_00313695 predicted 1012
7 SASI_Hs02_00313696 predicted 1032
8 SASI_Hs02_00313697 predicted 814
9 SASI_Hs02_00313698 predicted 900
10 SASI_Hs02_00313699 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098112 predicted 801
2 SASI_Hs01_00098114 predicted 828
3 SASI_Hs02_00361493 predicted 812
4 SASI_Hs01_00098116 predicted 815
5 SASI_Hs01_00098117 predicted 994
6 SASI_Hs01_00098119 predicted 1021
7 SASI_Hs02_00361494 predicted 1039
8 SASI_Hs02_00361495 predicted 824
9 SASI_Hs01_00098120 predicted 905
10 SASI_Hs02_00361496 predicted 948
11 SASI_Hs01_00098113 predicted 971
12 SASI_Hs01_00098115 predicted 563
13 SASI_Hs01_00098118 predicted 692
14 SASI_Hs01_00098121 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204170 predicted 523
2 SASI_Rn02_00204171 predicted 886
3 SASI_Rn02_00204172 predicted 1024
4 SASI_Rn02_00204173 predicted 1050
5 SASI_Rn02_00204174 predicted 914
6 SASI_Rn02_00204175 predicted 840
7 SASI_Rn02_00204176 predicted 926
8 SASI_Rn02_00204177 predicted 1085
9 SASI_Rn02_00204178 predicted 872
10 SASI_Rn02_00204179 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304322 predicted 532
2 SASI_Rn02_00304323 predicted 604
3 SASI_Rn02_00304324 predicted 425
4 SASI_Rn02_00304325 predicted 587
5 SASI_Rn02_00304326 predicted 529
6 SASI_Rn02_00304327 predicted 517
7 SASI_Rn02_00304328 predicted 384
8 SASI_Rn02_00304329 predicted 497
9 SASI_Rn02_00304330 predicted 546
10 SASI_Rn02_00304331 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333398 predicted 345
2 SASI_Rn02_00333399 predicted 357
3 SASI_Rn02_00333400 predicted 313
4 SASI_Rn02_00333401 predicted 363
5 SASI_Rn02_00333402 predicted 253
6 SASI_Rn02_00333403 predicted 353
7 SASI_Rn02_00333404 predicted 316
8 SASI_Rn02_00333405 predicted 358
9 SASI_Rn02_00333406 predicted 255
10 SASI_Rn02_00333407 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338952 predicted 621
2 SASI_Mm01_00100538 predicted 895
3 SASI_Mm01_00100539 predicted 536
4 SASI_Mm02_00338953 predicted 545
5 SASI_Mm01_00100540 predicted 1076
6 SASI_Mm01_00100541 predicted 1041
7 SASI_Mm01_00100542 predicted 934
8 SASI_Mm01_00100543 predicted 1041
9 SASI_Mm01_00100544 predicted 832
10 SASI_Mm01_00100545 predicted 535
11 SASI_Mm01_00100546 predicted 447
12 SASI_Mm01_00100547 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133898
N4BP2L1 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-1250s21c1
Sequence:CCGGGAGACCTGAGCCGTCACTTTACTCGAGTAAAGTGACGGCTCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-510s1c1
Sequence:CCGGGTTAGCAAGAAGAAACATCCACTCGAGTGGATGTTTCTTCTTGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-787s21c1
Sequence:CCGGGCCACCACCAAGGATATTAATCTCGAGATTAATATCCTTGGTGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133898.1-1563s1c1
Sequence:CCGGCCAGGGTGATACAAGGAGATACTCGAGTATCTCCTTGTATCACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-605s21c1
Sequence:CCGGACGGTATGAACACAATGTTACCTCGAGGTAACATTGTGTTCATACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-442s1c1
Sequence:CCGGGCTCTTGAGAATAACTATGAACTCGAGTTCATAGTTATTCTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-487s1c1
Sequence:CCGGCGCTGGAAATTCAACGTTCAACTCGAGTTGAACGTTGAATTTCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-893s21c1
Sequence:CCGGGAGCTCTAAGTCCAGTGTAAACTCGAGTTTACACTGGACTTAGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-747s21c1
Sequence:CCGGGCTAATGGCCTCTACTCCAACCTCGAGGTTGGAGTAGAGGCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-935s21c1
Sequence:CCGGGAACAGAGGTCATTCTATTTACTCGAGTAAATAGAATGACCTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133898
N4BP2L1 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-1250s21c1
Sequence:CCGGGAGACCTGAGCCGTCACTTTACTCGAGTAAAGTGACGGCTCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-510s1c1
Sequence:CCGGGTTAGCAAGAAGAAACATCCACTCGAGTGGATGTTTCTTCTTGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-787s21c1
Sequence:CCGGGCCACCACCAAGGATATTAATCTCGAGATTAATATCCTTGGTGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133898.1-1563s1c1
Sequence:CCGGCCAGGGTGATACAAGGAGATACTCGAGTATCTCCTTGTATCACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-605s21c1
Sequence:CCGGACGGTATGAACACAATGTTACCTCGAGGTAACATTGTGTTCATACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-442s1c1
Sequence:CCGGGCTCTTGAGAATAACTATGAACTCGAGTTCATAGTTATTCTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-487s1c1
Sequence:CCGGCGCTGGAAATTCAACGTTCAACTCGAGTTGAACGTTGAATTTCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-893s21c1
Sequence:CCGGGAGCTCTAAGTCCAGTGTAAACTCGAGTTTACACTGGACTTAGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-747s21c1
Sequence:CCGGGCTAATGGCCTCTACTCCAACCTCGAGGTTGGAGTAGAGGCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-935s21c1
Sequence:CCGGGAACAGAGGTCATTCTATTTACTCGAGTAAATAGAATGACCTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133898
N4BP2L1 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-1250s21c1
Sequence:CCGGGAGACCTGAGCCGTCACTTTACTCGAGTAAAGTGACGGCTCAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-510s1c1
Sequence:CCGGGTTAGCAAGAAGAAACATCCACTCGAGTGGATGTTTCTTCTTGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-787s21c1
Sequence:CCGGGCCACCACCAAGGATATTAATCTCGAGATTAATATCCTTGGTGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133898.1-1563s1c1
Sequence:CCGGCCAGGGTGATACAAGGAGATACTCGAGTATCTCCTTGTATCACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-605s21c1
Sequence:CCGGACGGTATGAACACAATGTTACCTCGAGGTAACATTGTGTTCATACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-442s1c1
Sequence:CCGGGCTCTTGAGAATAACTATGAACTCGAGTTCATAGTTATTCTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133898.1-487s1c1
Sequence:CCGGCGCTGGAAATTCAACGTTCAACTCGAGTTGAACGTTGAATTTCCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-893s21c1
Sequence:CCGGGAGCTCTAAGTCCAGTGTAAACTCGAGTTTACACTGGACTTAGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133898.4-747s21c1
Sequence:CCGGGCTAATGGCCTCTACTCCAACCTCGAGGTTGGAGTAGAGGCCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133898.4-935s21c1
Sequence:CCGGGAACAGAGGTCATTCTATTTACTCGAGTAAATAGAATGACCTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052818
N4BP2L1 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1111s21c1
Sequence:CCGGACATAGGTTCATAGATGAAATCTCGAGATTTCATCTATGAACCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-912s21c1
Sequence:CCGGGCTCCAATTCCAGTGTAAATACTCGAGTATTTACACTGGAATTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-633s1c1
Sequence:CCGGCGGTATGAACACGATGTTACTCTCGAGAGTAACATCGTGTTCATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-617s1c1
Sequence:CCGGCCACCGAATGAAAGAACGGTACTCGAGTACCGTTCTTTCATTCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-525s1c1
Sequence:CCGGGAAGTTATATTCCGAGAACCTCTCGAGAGGTTCTCGGAATATAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-784s1c1
Sequence:CCGGGTGGATTTACAAATGAGAGCTCTCGAGAGCTCTCATTTGTAAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052818.1-1407s1c1
Sequence:CCGGGTAGACACTTTGGGAAGTTATCTCGAGATAACTTCCCAAAGTGTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-586s1c1
Sequence:CCGGGAAACATTCATGGTGTCTCAACTCGAGTTGAGACACCATGAATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1248s21c1
Sequence:CCGGGGGCATTGCTACTTATCAAAGCTCGAGCTTTGATAAGTAGCAATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052818
N4BP2L1 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1111s21c1
Sequence:CCGGACATAGGTTCATAGATGAAATCTCGAGATTTCATCTATGAACCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-912s21c1
Sequence:CCGGGCTCCAATTCCAGTGTAAATACTCGAGTATTTACACTGGAATTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-633s1c1
Sequence:CCGGCGGTATGAACACGATGTTACTCTCGAGAGTAACATCGTGTTCATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-617s1c1
Sequence:CCGGCCACCGAATGAAAGAACGGTACTCGAGTACCGTTCTTTCATTCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-525s1c1
Sequence:CCGGGAAGTTATATTCCGAGAACCTCTCGAGAGGTTCTCGGAATATAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-784s1c1
Sequence:CCGGGTGGATTTACAAATGAGAGCTCTCGAGAGCTCTCATTTGTAAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052818.1-1407s1c1
Sequence:CCGGGTAGACACTTTGGGAAGTTATCTCGAGATAACTTCCCAAAGTGTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-586s1c1
Sequence:CCGGGAAACATTCATGGTGTCTCAACTCGAGTTGAGACACCATGAATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1248s21c1
Sequence:CCGGGGGCATTGCTACTTATCAAAGCTCGAGCTTTGATAAGTAGCAATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052818
N4BP2L1 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1111s21c1
Sequence:CCGGACATAGGTTCATAGATGAAATCTCGAGATTTCATCTATGAACCTATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-912s21c1
Sequence:CCGGGCTCCAATTCCAGTGTAAATACTCGAGTATTTACACTGGAATTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-633s1c1
Sequence:CCGGCGGTATGAACACGATGTTACTCTCGAGAGTAACATCGTGTTCATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-617s1c1
Sequence:CCGGCCACCGAATGAAAGAACGGTACTCGAGTACCGTTCTTTCATTCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-525s1c1
Sequence:CCGGGAAGTTATATTCCGAGAACCTCTCGAGAGGTTCTCGGAATATAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-784s1c1
Sequence:CCGGGTGGATTTACAAATGAGAGCTCTCGAGAGCTCTCATTTGTAAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052818.1-1407s1c1
Sequence:CCGGGTAGACACTTTGGGAAGTTATCTCGAGATAACTTCCCAAAGTGTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052818.1-586s1c1
Sequence:CCGGGAAACATTCATGGTGTCTCAACTCGAGTTGAGACACCATGAATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052818.2-1248s21c1
Sequence:CCGGGGGCATTGCTACTTATCAAAGCTCGAGCTTTGATAAGTAGCAATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)