EMAIL THIS PAGE TO A FRIEND

N4BP2L2

NEDD4 binding protein 2-like 2

117 Gene Product Result for
Synonyms: 92M18.3 CG005 PFAAP5
UniProtKB ID: Q92802, A3KME8
Gene ID:
Mouse(381695) NEDD4 binding protein 2-like 2
Rat(288416) NEDD4 binding protein 2-like 2
chicken(418912) NEDD4 binding protein 2-like 2
cow(541201) NEDD4 binding protein 2-like 2
domestic cat(101080934) NEDD4 binding protein 2-like 2
dog(477316) NEDD4 binding protein 2-like 2
naked mole-rat(101697387) NEDD4 binding protein 2-like 2
Domestic Rabbit(100358648) NEDD4 binding protein 2-like 2
domestic guinea pig(100713411) NEDD4 binding protein 2-like 2
sheep(101109457) NEDD4 binding protein 2-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014887 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014887 Rosetta Predictions human pricing
NM_033111 Rosetta Predictions human pricing
NM_001005533 Rosetta Predictions rat pricing
NM_201369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346510 predicted 595
2 SASI_Hs01_00021764 predicted 911
3 SASI_Hs01_00021766 predicted 1137
4 SASI_Hs01_00021767 predicted 1025
5 SASI_Hs01_00021769 predicted 1435
6 SASI_Hs01_00021770 predicted 450
7 SASI_Hs02_00346511 predicted 681
8 SASI_Hs01_00021772 predicted 362
9 SASI_Hs01_00021773 predicted 1249
10 SASI_Hs02_00346512 predicted 1292
11 SASI_Hs01_00021765 predicted 902
12 SASI_Hs01_00021768 predicted 889
13 SASI_Hs01_00021771 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126254 predicted 1663
2 SASI_Hs01_00126255 predicted 638
3 SASI_Hs01_00126256 predicted 730
4 SASI_Hs01_00126257 predicted 2070
5 SASI_Hs01_00126258 predicted 1378
6 SASI_Hs01_00126259 predicted 536
7 SASI_Hs01_00126260 predicted 1887
8 SASI_Hs02_00360828 predicted 1333
9 SASI_Hs02_00360829 predicted 762
10 SASI_Hs01_00126261 predicted 818
11 SASI_Hs01_00126262 predicted 1195
12 SASI_Hs01_00126263 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050977 predicted 808
2 SASI_Rn01_00050978 predicted 1464
3 SASI_Rn01_00050979 predicted 1234
4 SASI_Rn01_00050980 predicted 1013
5 SASI_Rn01_00050981 predicted 1394
6 SASI_Rn01_00050982 predicted 1634
7 SASI_Rn01_00050983 predicted 1048
8 SASI_Rn01_00050984 predicted 1060
9 SASI_Rn02_00198385 predicted 1365
10 SASI_Rn02_00198386 predicted 1083
11 SASI_Rn01_00050976 predicted 1660
12 SASI_Rn01_00050985 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351535 predicted 1113
2 SASI_Mm02_00351536 predicted 332
3 SASI_Mm02_00351537 predicted 787
4 SASI_Mm02_00351538 predicted 820
5 SASI_Mm02_00351539 predicted 1239
6 SASI_Mm02_00351540 predicted 1071
7 SASI_Mm02_00351541 predicted 1233
8 SASI_Mm02_00351542 predicted 711
9 SASI_Mm02_00351543 predicted 722
10 SASI_Mm02_00351544 predicted 1593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033111
N4BP2L2 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1889s21c1
Sequence:CCGGCAGACAAGAGTAGGTAATAAACTCGAGTTTATTACCTACTCTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-2122s21c1
Sequence:CCGGGTTTGCCTTTCAATTAGTAAACTCGAGTTTACTAATTGAAAGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-962s21c1
Sequence:CCGGGCGGAAACTTCATGCTTATTTCTCGAGAAATAAGCATGAAGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1425s21c1
Sequence:CCGGGCTTACCTCAACCGGATATACCTCGAGGTATATCCGGTTGAGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1396s1c1
Sequence:CCGGCCTCTCTAAGGAAGGTGATAACTCGAGTTATCACCTTCCTTAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1653s1c1
Sequence:CCGGGCCATCAACATGGAATCAGAACTCGAGTTCTGATTCCATGTTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1943s1c1
Sequence:CCGGCCAGAAATATTGACAGACAAACTCGAGTTTGTCTGTCAATATTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1654s1c1
Sequence:CCGGCCATCAACATGGAATCAGAATCTCGAGATTCTGATTCCATGTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1808s1c1
Sequence:CCGGGCAGGACCTCATAAGTTTATACTCGAGTATAAACTTATGAGGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-2712s1c1
Sequence:CCGGGTTCCCTTGAGCTACCATTATCTCGAGATAATGGTAGCTCAAGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033111
N4BP2L2 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1889s21c1
Sequence:CCGGCAGACAAGAGTAGGTAATAAACTCGAGTTTATTACCTACTCTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-2122s21c1
Sequence:CCGGGTTTGCCTTTCAATTAGTAAACTCGAGTTTACTAATTGAAAGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-962s21c1
Sequence:CCGGGCGGAAACTTCATGCTTATTTCTCGAGAAATAAGCATGAAGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1425s21c1
Sequence:CCGGGCTTACCTCAACCGGATATACCTCGAGGTATATCCGGTTGAGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1396s1c1
Sequence:CCGGCCTCTCTAAGGAAGGTGATAACTCGAGTTATCACCTTCCTTAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1653s1c1
Sequence:CCGGGCCATCAACATGGAATCAGAACTCGAGTTCTGATTCCATGTTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1943s1c1
Sequence:CCGGCCAGAAATATTGACAGACAAACTCGAGTTTGTCTGTCAATATTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1654s1c1
Sequence:CCGGCCATCAACATGGAATCAGAATCTCGAGATTCTGATTCCATGTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1808s1c1
Sequence:CCGGGCAGGACCTCATAAGTTTATACTCGAGTATAAACTTATGAGGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-2712s1c1
Sequence:CCGGGTTCCCTTGAGCTACCATTATCTCGAGATAATGGTAGCTCAAGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033111
N4BP2L2 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1889s21c1
Sequence:CCGGCAGACAAGAGTAGGTAATAAACTCGAGTTTATTACCTACTCTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-2122s21c1
Sequence:CCGGGTTTGCCTTTCAATTAGTAAACTCGAGTTTACTAATTGAAAGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-962s21c1
Sequence:CCGGGCGGAAACTTCATGCTTATTTCTCGAGAAATAAGCATGAAGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033111.3-1425s21c1
Sequence:CCGGGCTTACCTCAACCGGATATACCTCGAGGTATATCCGGTTGAGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1396s1c1
Sequence:CCGGCCTCTCTAAGGAAGGTGATAACTCGAGTTATCACCTTCCTTAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1653s1c1
Sequence:CCGGGCCATCAACATGGAATCAGAACTCGAGTTCTGATTCCATGTTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1943s1c1
Sequence:CCGGCCAGAAATATTGACAGACAAACTCGAGTTTGTCTGTCAATATTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1654s1c1
Sequence:CCGGCCATCAACATGGAATCAGAATCTCGAGATTCTGATTCCATGTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-1808s1c1
Sequence:CCGGGCAGGACCTCATAAGTTTATACTCGAGTATAAACTTATGAGGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033111.2-2712s1c1
Sequence:CCGGGTTCCCTTGAGCTACCATTATCTCGAGATAATGGTAGCTCAAGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201369
N4BP2L2 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2-like 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-7074s1c1
Sequence:CCGGGGTGTTGTATTGCAATGATTACTCGAGTAATCATTGCAATACAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-2520s1c1
Sequence:CCGGGTAATCCACTGACAACATATACTCGAGTATATGTTGTCAGTGGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-702s1c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-1081s1c1
Sequence:CCGGGTTTGATCAGAACGATGAATACTCGAGTATTCATCGTTCTGATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1108s21c1
Sequence:CCGGCTATGATGTGACTAGCAATAACTCGAGTTATTGCTAGTCACATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-164s21c1
Sequence:CCGGACAAGAGAACCATGCTATAAACTCGAGTTTATAGCATGGTTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201369.3-2298s21c1
Sequence:CCGGATTAGCTCTAAGCCATAATTACTCGAGTAATTATGGCTTAGAGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1492s21c1
Sequence:CCGGAGGGAGATCTCCAGTTATAATCTCGAGATTATAACTGGAGATCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-702s21c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.1-3126s1c1
Sequence:CCGGGCCTCGTTACATTATATTGAACTCGAGTTCAATATAATGTAACGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-1087s1c1
Sequence:CCGGGCAATAATGTTCATCCCTTTACTCGAGTAAAGGGATGAACATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-406s1c1
Sequence:CCGGCCAAGGATGATGAAATCTATACTCGAGTATAGATTTCATCATCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201369
N4BP2L2 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2-like 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-7074s1c1
Sequence:CCGGGGTGTTGTATTGCAATGATTACTCGAGTAATCATTGCAATACAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-2520s1c1
Sequence:CCGGGTAATCCACTGACAACATATACTCGAGTATATGTTGTCAGTGGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-702s1c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-1081s1c1
Sequence:CCGGGTTTGATCAGAACGATGAATACTCGAGTATTCATCGTTCTGATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1108s21c1
Sequence:CCGGCTATGATGTGACTAGCAATAACTCGAGTTATTGCTAGTCACATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-164s21c1
Sequence:CCGGACAAGAGAACCATGCTATAAACTCGAGTTTATAGCATGGTTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201369.3-2298s21c1
Sequence:CCGGATTAGCTCTAAGCCATAATTACTCGAGTAATTATGGCTTAGAGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1492s21c1
Sequence:CCGGAGGGAGATCTCCAGTTATAATCTCGAGATTATAACTGGAGATCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-702s21c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.1-3126s1c1
Sequence:CCGGGCCTCGTTACATTATATTGAACTCGAGTTCAATATAATGTAACGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-1087s1c1
Sequence:CCGGGCAATAATGTTCATCCCTTTACTCGAGTAAAGGGATGAACATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-406s1c1
Sequence:CCGGCCAAGGATGATGAAATCTATACTCGAGTATAGATTTCATCATCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201369
N4BP2L2 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2-like 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-7074s1c1
Sequence:CCGGGGTGTTGTATTGCAATGATTACTCGAGTAATCATTGCAATACAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.3-2520s1c1
Sequence:CCGGGTAATCCACTGACAACATATACTCGAGTATATGTTGTCAGTGGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-702s1c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.3-1081s1c1
Sequence:CCGGGTTTGATCAGAACGATGAATACTCGAGTATTCATCGTTCTGATCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1108s21c1
Sequence:CCGGCTATGATGTGACTAGCAATAACTCGAGTTATTGCTAGTCACATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-164s21c1
Sequence:CCGGACAAGAGAACCATGCTATAAACTCGAGTTTATAGCATGGTTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201369.3-2298s21c1
Sequence:CCGGATTAGCTCTAAGCCATAATTACTCGAGTAATTATGGCTTAGAGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-1492s21c1
Sequence:CCGGAGGGAGATCTCCAGTTATAATCTCGAGATTATAACTGGAGATCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201369.3-702s21c1
Sequence:CCGGCTTCCGAAGAACCAATTATTTCTCGAGAAATAATTGGTTCTTCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201369.1-3126s1c1
Sequence:CCGGGCCTCGTTACATTATATTGAACTCGAGTTCAATATAATGTAACGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-1087s1c1
Sequence:CCGGGCAATAATGTTCATCCCTTTACTCGAGTAAAGGGATGAACATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201369.1-406s1c1
Sequence:CCGGCCAAGGATGATGAAATCTATACTCGAGTATAGATTTCATCATCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014887
VALIDATED
N4BP2L2 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 2-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-891s1c1
Sequence:CCGGGCCAGACAAATATCCCTGTAACTCGAGTTACAGGGATATTTGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014887.1-1750s1c1
Sequence:CCGGGCTCAGATGTTGGATCGTTATCTCGAGATAACGATCCAACATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-202s1c1
Sequence:CCGGCCTAGAGAAGAAGTAACGAGTCTCGAGACTCGTTACTTCTTCTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2388s1c1
Sequence:CCGGGCTGATTGATCTGTGTGACAACTCGAGTTGTCACACAGATCAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-1482s1c1
Sequence:CCGGCCATCAAGATGGGTACAGGTACTCGAGTACCTGTACCCATCTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-2598s1c1
Sequence:CCGGGAAGGGATAAAGTGATTCTAACTCGAGTTAGAATCACTTTATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2588s1c1
Sequence:CCGGGCCAGTTCTTGAAGGGATAAACTCGAGTTTATCCCTTCAAGAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-761s1c1
Sequence:CCGGCTCAGGAACAATTTGTTCCATCTCGAGATGGAACAAATTGTTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014887
VALIDATED
N4BP2L2 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 2-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-891s1c1
Sequence:CCGGGCCAGACAAATATCCCTGTAACTCGAGTTACAGGGATATTTGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014887.1-1750s1c1
Sequence:CCGGGCTCAGATGTTGGATCGTTATCTCGAGATAACGATCCAACATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-202s1c1
Sequence:CCGGCCTAGAGAAGAAGTAACGAGTCTCGAGACTCGTTACTTCTTCTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2388s1c1
Sequence:CCGGGCTGATTGATCTGTGTGACAACTCGAGTTGTCACACAGATCAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-1482s1c1
Sequence:CCGGCCATCAAGATGGGTACAGGTACTCGAGTACCTGTACCCATCTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-2598s1c1
Sequence:CCGGGAAGGGATAAAGTGATTCTAACTCGAGTTAGAATCACTTTATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2588s1c1
Sequence:CCGGGCCAGTTCTTGAAGGGATAAACTCGAGTTTATCCCTTCAAGAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-761s1c1
Sequence:CCGGCTCAGGAACAATTTGTTCCATCTCGAGATGGAACAAATTGTTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014887
VALIDATED
N4BP2L2 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 2-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-891s1c1
Sequence:CCGGGCCAGACAAATATCCCTGTAACTCGAGTTACAGGGATATTTGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014887.1-1750s1c1
Sequence:CCGGGCTCAGATGTTGGATCGTTATCTCGAGATAACGATCCAACATCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-202s1c1
Sequence:CCGGCCTAGAGAAGAAGTAACGAGTCTCGAGACTCGTTACTTCTTCTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2388s1c1
Sequence:CCGGGCTGATTGATCTGTGTGACAACTCGAGTTGTCACACAGATCAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-1482s1c1
Sequence:CCGGCCATCAAGATGGGTACAGGTACTCGAGTACCTGTACCCATCTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014887.1-2598s1c1
Sequence:CCGGGAAGGGATAAAGTGATTCTAACTCGAGTTAGAATCACTTTATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014887.1-2588s1c1
Sequence:CCGGGCCAGTTCTTGAAGGGATAAACTCGAGTTTATCCCTTCAAGAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014887.1-761s1c1
Sequence:CCGGCTCAGGAACAATTTGTTCCATCTCGAGATGGAACAAATTGTTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)