EMAIL THIS PAGE TO A FRIEND

N4BP3

NEDD4 binding protein 3

146 Gene Product Result for
Synonyms: LZTS4
UniProtKB ID: O15049, B4DIL3, D3DWP3, Q6ZSQ6, Q7Z6I3
Gene ID:
Mouse(212706) NEDD4 binding protein 3
Rat(303112) Nedd4 binding protein 3
chicken(431542) NEDD4 binding protein 3
cow(513032) NEDD4 binding protein 3
Horse(100058182) NEDD4 binding protein 3
domestic cat(101088643) NEDD4 binding protein 3
dog(481446) NEDD4 binding protein 3
sheep(101107786) NEDD4 binding protein 3
domestic guinea pig(100724609) NEDD4 binding protein 3
naked mole-rat(101709777) NEDD4 binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_038920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038920 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU050101 MISSION® esiRNA esiRNA targeting mouse C330016O10Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015111 Rosetta Predictions human pricing
NM_001033893 Rosetta Predictions rat pricing
NM_145974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025527 predicted 494
2 SASI_Hs02_00346999 predicted 1768
3 SASI_Hs01_00025528 predicted 1426
4 SASI_Hs01_00025529 predicted 1714
5 SASI_Hs01_00025530 predicted 2299
6 SASI_Hs01_00025532 predicted 500
7 SASI_Hs01_00025533 predicted 635
8 SASI_Hs01_00025534 predicted 472
9 SASI_Hs01_00025535 predicted 534
10 SASI_Hs01_00025536 predicted 403
11 SASI_Hs01_00025531 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116174 predicted 792
2 SASI_Rn01_00116175 predicted 673
3 SASI_Rn01_00116176 predicted 1103
4 SASI_Rn01_00116177 predicted 1498
5 SASI_Rn01_00116178 predicted 755
6 SASI_Rn01_00116179 predicted 1791
7 SASI_Rn01_00116180 predicted 228
8 SASI_Rn01_00116181 predicted 1087
9 SASI_Rn01_00116182 predicted 868
10 SASI_Rn02_00203792 predicted 208
11 SASI_Rn01_00116173 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083215 predicted 1237
2 SASI_Mm01_00083216 predicted 2048
3 SASI_Mm01_00083217 predicted 1523
4 SASI_Mm01_00083218 predicted 739
5 SASI_Mm01_00083219 predicted 2205
6 SASI_Mm01_00083220 predicted 1031
7 SASI_Mm01_00083221 predicted 2197
8 SASI_Mm01_00083222 predicted 2176
9 SASI_Mm01_00083224 predicted 1229
10 SASI_Mm02_00341473 predicted 458
11 SASI_Mm01_00083223 predicted 2258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145974
N4BP3 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-356s1c1
Sequence:CCGGGAGTTCTTCAGCTACCTGCATCTCGAGATGCAGGTAGCTGAAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-465s1c1
Sequence:CCGGCTGGTGACTTCAGCAAGACTTCTCGAGAAGTCTTGCTGAAGTCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1319s21c1
Sequence:CCGGTTCATGAGGTGGCCCAGAAAGCTCGAGCTTTCTGGGCCACCTCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145974.3-2409s21c1
Sequence:CCGGAGATTGGCCACCTCCAGAATACTCGAGTATTCTGGAGGTGGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1232s21c1
Sequence:CCGGAGGATGTTTCTAACTCCTTTACTCGAGTAAAGGAGTTAGAAACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-733s21c1
Sequence:CCGGCGCTTTGACAAGTGCCGAATCCTCGAGGATTCGGCACTTGTCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1036s21c1
Sequence:CCGGTCCTCCTTGGGCCACATTAATCTCGAGATTAATGTGGCCCAAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145974
N4BP3 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-356s1c1
Sequence:CCGGGAGTTCTTCAGCTACCTGCATCTCGAGATGCAGGTAGCTGAAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-465s1c1
Sequence:CCGGCTGGTGACTTCAGCAAGACTTCTCGAGAAGTCTTGCTGAAGTCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1319s21c1
Sequence:CCGGTTCATGAGGTGGCCCAGAAAGCTCGAGCTTTCTGGGCCACCTCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145974.3-2409s21c1
Sequence:CCGGAGATTGGCCACCTCCAGAATACTCGAGTATTCTGGAGGTGGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1232s21c1
Sequence:CCGGAGGATGTTTCTAACTCCTTTACTCGAGTAAAGGAGTTAGAAACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-733s21c1
Sequence:CCGGCGCTTTGACAAGTGCCGAATCCTCGAGGATTCGGCACTTGTCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1036s21c1
Sequence:CCGGTCCTCCTTGGGCCACATTAATCTCGAGATTAATGTGGCCCAAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145974
N4BP3 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-356s1c1
Sequence:CCGGGAGTTCTTCAGCTACCTGCATCTCGAGATGCAGGTAGCTGAAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145974.2-465s1c1
Sequence:CCGGCTGGTGACTTCAGCAAGACTTCTCGAGAAGTCTTGCTGAAGTCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1319s21c1
Sequence:CCGGTTCATGAGGTGGCCCAGAAAGCTCGAGCTTTCTGGGCCACCTCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145974.3-2409s21c1
Sequence:CCGGAGATTGGCCACCTCCAGAATACTCGAGTATTCTGGAGGTGGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1232s21c1
Sequence:CCGGAGGATGTTTCTAACTCCTTTACTCGAGTAAAGGAGTTAGAAACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-733s21c1
Sequence:CCGGCGCTTTGACAAGTGCCGAATCCTCGAGGATTCGGCACTTGTCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145974.3-1036s21c1
Sequence:CCGGTCCTCCTTGGGCCACATTAATCTCGAGATTAATGTGGCCCAAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038920
N4BP3 MISSION shRNA Bacterial Glycerol Stock
NEDD4 binding protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-289s1c1
Sequence:CCGGCGCTTTGACAAGTGCCGCATTCTCGAGAATGCGGCACTTGTCAAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-722s1c1
Sequence:CCGGCCTGCTCCTCTGCCGAGGAAACTCGAGTTTCCTCGGCAGAGGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-1082s1c1
Sequence:CCGGGCCAGAAGACAGCAGAGATTACTCGAGTAATCTCTGCTGTCTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-224s1c1
Sequence:CCGGCCCTCTACTACCGGGAACATTCTCGAGAATGTTCCCGGTAGTAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-338s1c1
Sequence:CCGGGCAACGGGAAAGGCTTCCTATCTCGAGATAGGAAGCCTTTCCCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038920
N4BP3 MISSION shRNA shRNA Plasmid DNA
NEDD4 binding protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-289s1c1
Sequence:CCGGCGCTTTGACAAGTGCCGCATTCTCGAGAATGCGGCACTTGTCAAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-722s1c1
Sequence:CCGGCCTGCTCCTCTGCCGAGGAAACTCGAGTTTCCTCGGCAGAGGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-1082s1c1
Sequence:CCGGGCCAGAAGACAGCAGAGATTACTCGAGTAATCTCTGCTGTCTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-224s1c1
Sequence:CCGGCCCTCTACTACCGGGAACATTCTCGAGAATGTTCCCGGTAGTAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-338s1c1
Sequence:CCGGGCAACGGGAAAGGCTTCCTATCTCGAGATAGGAAGCCTTTCCCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038920
N4BP3 MISSION shRNA Lentiviral Transduction Particles
NEDD4 binding protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-289s1c1
Sequence:CCGGCGCTTTGACAAGTGCCGCATTCTCGAGAATGCGGCACTTGTCAAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-722s1c1
Sequence:CCGGCCTGCTCCTCTGCCGAGGAAACTCGAGTTTCCTCGGCAGAGGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-1082s1c1
Sequence:CCGGGCCAGAAGACAGCAGAGATTACTCGAGTAATCTCTGCTGTCTTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-224s1c1
Sequence:CCGGCCCTCTACTACCGGGAACATTCTCGAGAATGTTCCCGGTAGTAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038920.8-338s1c1
Sequence:CCGGGCAACGGGAAAGGCTTCCTATCTCGAGATAGGAAGCCTTTCCCGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)