EMAIL THIS PAGE TO A FRIEND

N6AMT1

N-6 adenine-specific DNA methyltransferase 1 (putative)

306 Gene Product Result for
Synonyms: C21orf127 HEMK2 MTQ2 N6AMT
UniProtKB ID: Q9Y5N5, Q96F73
Gene ID:
Human(29104) Summary: This gene encodes protein methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 11. [provided by RefSeq, Mar 2012]
Mouse(67768) N-6 adenine-specific DNA methyltransferase 1 (putative)
Rat(288309) N-6 adenine-specific DNA methyltransferase 1 (putative)
Zebrafish(436775) N-6 adenine-specific DNA methyltransferase 1 (putative)
chicken(418481) N-6 adenine-specific DNA methyltransferase 1 (putative)
dog(487715) N-6 adenine-specific DNA methyltransferase 1 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013240 Rosetta Predictions human pricing
NM_182749 Rosetta Predictions human pricing
XM_001070533 Rosetta Predictions rat pricing
XM_213675 Rosetta Predictions rat pricing
NM_026366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344436 predicted 346
2 SASI_Hs02_00344437 predicted 332
3 SASI_Hs02_00344438 predicted 630
4 SASI_Hs02_00344439 predicted 291
5 SASI_Hs02_00344440 predicted 317
6 SASI_Hs02_00344441 predicted 413
7 SASI_Hs02_00344442 predicted 291
8 SASI_Hs02_00344443 predicted 232
9 SASI_Hs02_00344444 predicted 590
10 SASI_Hs02_00344445 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370900 predicted 281
2 SASI_Hs02_00370901 predicted 543
3 SASI_Hs02_00370902 predicted 327
4 SASI_Hs02_00370903 predicted 292
5 SASI_Hs02_00370904 predicted 292
6 SASI_Hs02_00370905 predicted 336
7 SASI_Hs02_00370906 predicted 310
8 SASI_Hs02_00370907 predicted 232
9 SASI_Hs02_00370908 predicted 513
10 SASI_Hs02_00370909 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331995 predicted 410
2 SASI_Rn02_00331996 predicted 432
3 SASI_Rn02_00331997 predicted 224
4 SASI_Rn02_00331998 predicted 302
5 SASI_Rn02_00331999 predicted 304
6 SASI_Rn02_00332000 predicted 301
7 SASI_Rn02_00332001 predicted 214
8 SASI_Rn02_00332002 predicted 321
9 SASI_Rn02_00332003 predicted 280
10 SASI_Rn02_00332004 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374806 predicted 637
2 SASI_Rn02_00374807 predicted 635
3 SASI_Rn02_00374808 predicted 704
4 SASI_Rn02_00374809 predicted 682
5 SASI_Rn02_00374810 predicted 680
6 SASI_Rn02_00374811 predicted 594
7 SASI_Rn02_00374812 predicted 618
8 SASI_Rn02_00374813 predicted 592
9 SASI_Rn02_00374814 predicted 692
10 SASI_Rn02_00374815 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330085 predicted 275
2 SASI_Mm02_00330086 predicted 197
3 SASI_Mm02_00330087 predicted 1064
4 SASI_Mm02_00330088 predicted 340
5 SASI_Mm02_00330089 predicted 352
6 SASI_Mm02_00330090 predicted 274
7 SASI_Mm02_00330091 predicted 1061
8 SASI_Mm02_00330092 predicted 366
9 SASI_Mm02_00330093 predicted 245
10 SASI_Mm02_00330094 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013240
N6AMT1 MISSION shRNA Bacterial Glycerol Stock
N-6 adenine-specific DNA methyltransferase 1 (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-810s21c1
Sequence:CCGGAGTCAGGCCTATAGAATTATTCTCGAGAATAATTCTATAGGCCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-297s1c1
Sequence:CCGGCGCTGTAACAAAGTTCACATTCTCGAGAATGTGAACTTTGTTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-372s1c1
Sequence:CCGGGTTGATCTTCTGGTGTTTAATCTCGAGATTAAACACCAGAAGATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-309s1c1
Sequence:CCGGGTTCACATTCAACCAGTTATTCTCGAGAATAACTGGTTGAATGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-635s1c1
Sequence:CCGGAGAAACTCTTTCAGTCCTCAACTCGAGTTGAGGACTGAAAGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-512s1c1
Sequence:CCGGCCTTTCACCAAGAGGATTATTCTCGAGAATAATCCTCTTGGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013240.3-242s21c1
Sequence:CCGGGTACATGTGCACTGATATCAACTCGAGTTGATATCAGTGCACATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-1047s21c1
Sequence:CCGGCTCCAACTCTATGTCATAATTCTCGAGAATTATGACATAGAGTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013240
N6AMT1 MISSION shRNA shRNA Plasmid DNA
N-6 adenine-specific DNA methyltransferase 1 (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-810s21c1
Sequence:CCGGAGTCAGGCCTATAGAATTATTCTCGAGAATAATTCTATAGGCCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-297s1c1
Sequence:CCGGCGCTGTAACAAAGTTCACATTCTCGAGAATGTGAACTTTGTTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-372s1c1
Sequence:CCGGGTTGATCTTCTGGTGTTTAATCTCGAGATTAAACACCAGAAGATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-309s1c1
Sequence:CCGGGTTCACATTCAACCAGTTATTCTCGAGAATAACTGGTTGAATGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-635s1c1
Sequence:CCGGAGAAACTCTTTCAGTCCTCAACTCGAGTTGAGGACTGAAAGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-512s1c1
Sequence:CCGGCCTTTCACCAAGAGGATTATTCTCGAGAATAATCCTCTTGGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013240.3-242s21c1
Sequence:CCGGGTACATGTGCACTGATATCAACTCGAGTTGATATCAGTGCACATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-1047s21c1
Sequence:CCGGCTCCAACTCTATGTCATAATTCTCGAGAATTATGACATAGAGTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013240
N6AMT1 MISSION shRNA Lentiviral Transduction Particles
N-6 adenine-specific DNA methyltransferase 1 (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-810s21c1
Sequence:CCGGAGTCAGGCCTATAGAATTATTCTCGAGAATAATTCTATAGGCCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-297s1c1
Sequence:CCGGCGCTGTAACAAAGTTCACATTCTCGAGAATGTGAACTTTGTTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-372s1c1
Sequence:CCGGGTTGATCTTCTGGTGTTTAATCTCGAGATTAAACACCAGAAGATCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-309s1c1
Sequence:CCGGGTTCACATTCAACCAGTTATTCTCGAGAATAACTGGTTGAATGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-635s1c1
Sequence:CCGGAGAAACTCTTTCAGTCCTCAACTCGAGTTGAGGACTGAAAGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013240.2-512s1c1
Sequence:CCGGCCTTTCACCAAGAGGATTATTCTCGAGAATAATCCTCTTGGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013240.3-242s21c1
Sequence:CCGGGTACATGTGCACTGATATCAACTCGAGTTGATATCAGTGCACATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013240.3-1047s21c1
Sequence:CCGGCTCCAACTCTATGTCATAATTCTCGAGAATTATGACATAGAGTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026366
VALIDATED
N6AMT1 MISSION shRNA Bacterial Glycerol Stock
N-6 adenine-specific DNA methyltransferase 1 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-571s1c1
Sequence:CCGGTGTTCTACTTAGTTACCGTAACTCGAGTTACGGTAACTAAGTAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-214s1c1
Sequence:CCGGGCCTTGAAGTAGGAGCAGGATCTCGAGATCCTGCTCCTACTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-461s1c1
Sequence:CCGGAGAGGTAGGAAGTCGTGGAATCTCGAGATTCCACGACTTCCTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-279s1c1
Sequence:CCGGGCCTTATACATGTGCACTGATCTCGAGATCAGTGCACATGTATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-692s1c1
Sequence:CCGGCCTCAGGTTCAGCAAGTCCTACTCGAGTAGGACTTGCTGAACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026366
VALIDATED
N6AMT1 MISSION shRNA shRNA Plasmid DNA
N-6 adenine-specific DNA methyltransferase 1 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-571s1c1
Sequence:CCGGTGTTCTACTTAGTTACCGTAACTCGAGTTACGGTAACTAAGTAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-214s1c1
Sequence:CCGGGCCTTGAAGTAGGAGCAGGATCTCGAGATCCTGCTCCTACTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-461s1c1
Sequence:CCGGAGAGGTAGGAAGTCGTGGAATCTCGAGATTCCACGACTTCCTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-279s1c1
Sequence:CCGGGCCTTATACATGTGCACTGATCTCGAGATCAGTGCACATGTATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-692s1c1
Sequence:CCGGCCTCAGGTTCAGCAAGTCCTACTCGAGTAGGACTTGCTGAACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026366
VALIDATED
N6AMT1 MISSION shRNA Lentiviral Transduction Particles
N-6 adenine-specific DNA methyltransferase 1 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-571s1c1
Sequence:CCGGTGTTCTACTTAGTTACCGTAACTCGAGTTACGGTAACTAAGTAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-214s1c1
Sequence:CCGGGCCTTGAAGTAGGAGCAGGATCTCGAGATCCTGCTCCTACTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026366.1-461s1c1
Sequence:CCGGAGAGGTAGGAAGTCGTGGAATCTCGAGATTCCACGACTTCCTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-279s1c1
Sequence:CCGGGCCTTATACATGTGCACTGATCTCGAGATCAGTGCACATGTATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026366.1-692s1c1
Sequence:CCGGCCTCAGGTTCAGCAAGTCCTACTCGAGTAGGACTTGCTGAACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)