EMAIL THIS PAGE TO A FRIEND

N6AMT2

N-6 adenine-specific DNA methyltransferase 2 (putative)

50 Gene Product Result for
Synonyms: ESP13
UniProtKB ID: Q8WVE0, B5G4V1
Gene ID:
Mouse(68043) N-6 adenine-specific DNA methyltransferase 2 (putative)
Rat(290279) N-6 adenine-specific DNA methyltransferase 2 (putative)
sheep(101117856) N-6 adenine-specific DNA methyltransferase 2 (putative)
domestic guinea pig(100724602) N-6 adenine-specific DNA methyltransferase 2 (putative)
naked mole-rat(101706285) N-6 adenine-specific DNA methyltransferase 2 (putative)
Zebrafish(404619) N-6 adenine-specific DNA methyltransferase 2 (putative)
chicken(418951) N-6 adenine-specific DNA methyltransferase 2 (putative)
cow(783374) N-6 adenine-specific DNA methyltransferase 2 (putative)
dog(486048) N-6 adenine-specific DNA methyltransferase 2 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174928 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174928 Rosetta Predictions human pricing
NM_001134990 Rosetta Predictions rat pricing
NM_026526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190548 predicted 403
2 SASI_Hs01_00190549 predicted 612
3 SASI_Hs01_00190550 predicted 616
4 SASI_Hs01_00190551 predicted 500
5 SASI_Hs01_00190552 predicted 455
6 SASI_Hs01_00190553 predicted 609
7 SASI_Hs01_00190554 predicted 278
8 SASI_Hs02_00368853 predicted 625
9 SASI_Hs01_00190555 predicted 630
10 SASI_Hs01_00190556 predicted 537
11 SASI_Hs01_00190547 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259284 predicted 657
2 SASI_Rn02_00259285 predicted 402
3 SASI_Rn02_00259286 predicted 214
4 SASI_Rn02_00259287 predicted 725
5 SASI_Rn02_00259288 predicted 490
6 SASI_Rn02_00259289 predicted 460
7 SASI_Rn02_00259290 predicted 330
8 SASI_Rn02_00259291 predicted 715
9 SASI_Rn02_00259292 predicted 498
10 SASI_Rn02_00259293 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119933 predicted 332
2 SASI_Mm01_00119934 predicted 420
3 SASI_Mm01_00119935 predicted 353
4 SASI_Mm01_00119936 predicted 347
5 SASI_Mm01_00119937 predicted 437
6 SASI_Mm01_00119938 predicted 228
7 SASI_Mm01_00119939 predicted 245
8 SASI_Mm01_00119940 predicted 453
9 SASI_Mm01_00119941 predicted 502
10 SASI_Mm01_00119942 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026526
VALIDATED
N6AMT2 MISSION shRNA Bacterial Glycerol Stock
N-6 adenine-specific DNA methyltransferase 2 (putative)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-503s1c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-359s1c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-54s1c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-647s1c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-444s1c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-358s21c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-502s21c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-53s21c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-443s21c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-646s21c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026526
VALIDATED
N6AMT2 MISSION shRNA shRNA Plasmid DNA
N-6 adenine-specific DNA methyltransferase 2 (putative)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-503s1c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-359s1c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-54s1c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-647s1c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-444s1c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-358s21c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-502s21c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-53s21c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-443s21c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-646s21c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026526
VALIDATED
N6AMT2 MISSION shRNA Lentiviral Transduction Particles
N-6 adenine-specific DNA methyltransferase 2 (putative)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-503s1c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-359s1c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-54s1c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-647s1c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026526.1-444s1c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-358s21c1
Sequence:CCGGCGACAGAAGATTCGCCATATACTCGAGTATATGGCGAATCTTCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-502s21c1
Sequence:CCGGGACATCTGAAACGATCCAGTTCTCGAGAACTGGATCGTTTCAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-53s21c1
Sequence:CCGGGAGTCAGAAGACGACGACATACTCGAGTATGTCGTCGTCTTCTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-443s21c1
Sequence:CCGGCATAGCTTTGACCTTGTGGTTCTCGAGAACCACAAGGTCAAAGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026526.2-646s21c1
Sequence:CCGGCCGCTGTTACACGAACTATGACTCGAGTCATAGTTCGTGTAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174928
N6AMT2 MISSION shRNA Bacterial Glycerol Stock
N-6 adenine-specific DNA methyltransferase 2 (putative)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-178s1c1
Sequence:CCGGCCAGGCGAGGATGATAAATATCTCGAGATATTTATCATCCTCGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-460s1c1
Sequence:CCGGCCCGAAAGAATTGCTGCACATCTCGAGATGTGCAGCAATTCTTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174928.1-732s1c1
Sequence:CCGGGACGGTGACATAACACAGGAACTCGAGTTCCTGTGTTATGTCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-219s1c1
Sequence:CCGGGAATTGGCAACTGAGCCAGTTCTCGAGAACTGGCTCAGTTGCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-514s1c1
Sequence:CCGGCTTTCGGAGGAATGTCTCAGACTCGAGTCTGAGACATTCCTCCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-660s1c1
Sequence:CCGGCCGGAACTTGGCAAATGAGTTCTCGAGAACTCATTTGCCAAGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-638s1c1
Sequence:CCGGGCACGTTTGTTCCAAGACACACTCGAGTGTGTCTTGGAACAAACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-670s1c1
Sequence:CCGGGCAAATGAGTTTCGCTGTTATCTCGAGATAACAGCGAAACTCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-409s21c1
Sequence:CCGGATGTATGGAGAGGAGTTTATTCTCGAGAATAAACTCCTCTCCATACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-434s21c1
Sequence:CCGGATGATTACAATAATCCATTGGCTCGAGCCAATGGATTATTGTAATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-626s21c1
Sequence:CCGGGAGTGAAGATGTGCACGTTTGCTCGAGCAAACGTGCACATCTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174928
N6AMT2 MISSION shRNA shRNA Plasmid DNA
N-6 adenine-specific DNA methyltransferase 2 (putative)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-178s1c1
Sequence:CCGGCCAGGCGAGGATGATAAATATCTCGAGATATTTATCATCCTCGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-460s1c1
Sequence:CCGGCCCGAAAGAATTGCTGCACATCTCGAGATGTGCAGCAATTCTTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174928.1-732s1c1
Sequence:CCGGGACGGTGACATAACACAGGAACTCGAGTTCCTGTGTTATGTCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-219s1c1
Sequence:CCGGGAATTGGCAACTGAGCCAGTTCTCGAGAACTGGCTCAGTTGCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-514s1c1
Sequence:CCGGCTTTCGGAGGAATGTCTCAGACTCGAGTCTGAGACATTCCTCCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-660s1c1
Sequence:CCGGCCGGAACTTGGCAAATGAGTTCTCGAGAACTCATTTGCCAAGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-638s1c1
Sequence:CCGGGCACGTTTGTTCCAAGACACACTCGAGTGTGTCTTGGAACAAACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-670s1c1
Sequence:CCGGGCAAATGAGTTTCGCTGTTATCTCGAGATAACAGCGAAACTCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-409s21c1
Sequence:CCGGATGTATGGAGAGGAGTTTATTCTCGAGAATAAACTCCTCTCCATACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-434s21c1
Sequence:CCGGATGATTACAATAATCCATTGGCTCGAGCCAATGGATTATTGTAATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-626s21c1
Sequence:CCGGGAGTGAAGATGTGCACGTTTGCTCGAGCAAACGTGCACATCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174928
N6AMT2 MISSION shRNA Lentiviral Transduction Particles
N-6 adenine-specific DNA methyltransferase 2 (putative)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-178s1c1
Sequence:CCGGCCAGGCGAGGATGATAAATATCTCGAGATATTTATCATCCTCGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-460s1c1
Sequence:CCGGCCCGAAAGAATTGCTGCACATCTCGAGATGTGCAGCAATTCTTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174928.1-732s1c1
Sequence:CCGGGACGGTGACATAACACAGGAACTCGAGTTCCTGTGTTATGTCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-219s1c1
Sequence:CCGGGAATTGGCAACTGAGCCAGTTCTCGAGAACTGGCTCAGTTGCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-514s1c1
Sequence:CCGGCTTTCGGAGGAATGTCTCAGACTCGAGTCTGAGACATTCCTCCGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-660s1c1
Sequence:CCGGCCGGAACTTGGCAAATGAGTTCTCGAGAACTCATTTGCCAAGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174928.1-638s1c1
Sequence:CCGGGCACGTTTGTTCCAAGACACACTCGAGTGTGTCTTGGAACAAACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174928.1-670s1c1
Sequence:CCGGGCAAATGAGTTTCGCTGTTATCTCGAGATAACAGCGAAACTCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-409s21c1
Sequence:CCGGATGTATGGAGAGGAGTTTATTCTCGAGAATAAACTCCTCTCCATACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-434s21c1
Sequence:CCGGATGATTACAATAATCCATTGGCTCGAGCCAATGGATTATTGTAATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174928.1-626s21c1
Sequence:CCGGGAGTGAAGATGTGCACGTTTGCTCGAGCAAACGTGCACATCTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)