EMAIL THIS PAGE TO A FRIEND

NAA11

N(alpha)-acetyltransferase 11, NatA catalytic subunit

55 Gene Product Result for
Synonyms: ARD1B ARD2 hARD2
UniProtKB ID: Q9BSU3, Q66K19, Q6P479
Gene ID:
Mouse(97243) N(alpha)-acetyltransferase 11, NatA catalytic subunit
Rat(289482) N(alpha)-acetyltransferase 11, NatA catalytic subunit
sheep(101112570) N(alpha)-acetyltransferase 11, NatA catalytic subunit
domestic guinea pig(100720190) N(alpha)-acetyltransferase 11, NatA catalytic subunit
naked mole-rat(101703587) N(alpha)-acetyltransferase 11, NatA catalytic subunit
dog(608326) N(alpha)-acetyltransferase 11, NatA catalytic subunit
cow(528769) N(alpha)-acetyltransferase 11, NatA catalytic subunit
domestic cat(101094415) N(alpha)-acetyltransferase 11, NatA catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106815 Anti-ARD1B antibody produced in rabbit affinity isolated antibody bovine, dog, yeast, horse, rabbit, mouse, rat, human, guinea pig
western blot pricing
HPA035922 Anti-NAA11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048631 MISSION® esiRNA esiRNA human ARD1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032693 Rosetta Predictions human pricing
XM_496704 Rosetta Predictions human pricing
NM_001024742 Rosetta Predictions rat pricing
NM_001033191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360228 predicted 985
2 SASI_Hs02_00360229 predicted 584
3 SASI_Hs02_00360230 predicted 821
4 SASI_Hs02_00360231 predicted 882
5 SASI_Hs02_00360232 predicted 608
6 SASI_Hs02_00360233 predicted 781
7 SASI_Hs02_00360234 predicted 759
8 SASI_Hs02_00360235 predicted 766
9 SASI_Hs02_00360236 predicted 702
10 SASI_Hs02_00360237 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265217 predicted 884
2 SASI_Hs01_00265218 predicted 467
3 SASI_Hs01_00265219 predicted 389
4 SASI_Hs01_00265220 predicted 785
5 SASI_Hs01_00265221 predicted 1498
6 SASI_Hs01_00265222 predicted 1482
7 SASI_Hs01_00265223 predicted 1498
8 SASI_Hs01_00265224 predicted 812
9 SASI_Hs01_00265225 predicted 555
10 SASI_Hs01_00265226 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039765 predicted 1119
2 SASI_Rn02_00202613 predicted 1109
3 SASI_Rn01_00039767 predicted 845
4 SASI_Rn01_00039768 predicted 836
5 SASI_Rn02_00202614 predicted 789
6 SASI_Rn02_00202615 predicted 1260
7 SASI_Rn01_00039771 predicted 1249
8 SASI_Rn01_00039772 predicted 954
9 SASI_Rn01_00039773 predicted 1131
10 SASI_Rn01_00039774 predicted 1071
11 SASI_Rn01_00039766 predicted 979
12 SASI_Rn01_00039769 predicted 1213
13 SASI_Rn01_00039770 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021479 predicted 956
2 SASI_Mm01_00021480 predicted 725
3 SASI_Mm01_00021481 predicted 744
4 SASI_Mm01_00021482 predicted 434
5 SASI_Mm01_00021483 predicted 988
6 SASI_Mm01_00021484 predicted 939
7 SASI_Mm02_00288295 predicted 1026
8 SASI_Mm01_00021485 predicted 1001
9 SASI_Mm01_00021486 predicted 1133
10 SASI_Mm01_00021487 predicted 487
11 SASI_Mm01_00021488 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033191
NAA11 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033191.2-1586s21c1
Sequence:CCGGGTATTTGCAAAGCGATGTTAACTCGAGTTAACATCGCTTTGCAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-677s21c1
Sequence:CCGGATTCCATCTCCTAGAGCATTTCTCGAGAAATGCTCTAGGAGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-465s21c1
Sequence:CCGGTTACGCCATGAAGCGGGATCTCTCGAGAGATCCCGCTTCATGGCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-520s21c1
Sequence:CCGGGTGCTGAAGAAGAACAGATATCTCGAGATATCTGTTCTTCTTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-318s21c1
Sequence:CCGGACGGGCGATGATCGAGAACTTCTCGAGAAGTTCTCGATCATCGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033191
NAA11 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033191.2-1586s21c1
Sequence:CCGGGTATTTGCAAAGCGATGTTAACTCGAGTTAACATCGCTTTGCAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-677s21c1
Sequence:CCGGATTCCATCTCCTAGAGCATTTCTCGAGAAATGCTCTAGGAGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-465s21c1
Sequence:CCGGTTACGCCATGAAGCGGGATCTCTCGAGAGATCCCGCTTCATGGCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-520s21c1
Sequence:CCGGGTGCTGAAGAAGAACAGATATCTCGAGATATCTGTTCTTCTTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-318s21c1
Sequence:CCGGACGGGCGATGATCGAGAACTTCTCGAGAAGTTCTCGATCATCGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033191
NAA11 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033191.2-1586s21c1
Sequence:CCGGGTATTTGCAAAGCGATGTTAACTCGAGTTAACATCGCTTTGCAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-677s21c1
Sequence:CCGGATTCCATCTCCTAGAGCATTTCTCGAGAAATGCTCTAGGAGATGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-465s21c1
Sequence:CCGGTTACGCCATGAAGCGGGATCTCTCGAGAGATCCCGCTTCATGGCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-520s21c1
Sequence:CCGGGTGCTGAAGAAGAACAGATATCTCGAGATATCTGTTCTTCTTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033191.2-318s21c1
Sequence:CCGGACGGGCGATGATCGAGAACTTCTCGAGAAGTTCTCGATCATCGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032693
NAA11 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-605s21c1
Sequence:CCGGAGATGAGCTGAGACGACAAATCTCGAGATTTGTCGTCTCAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-530s21c1
Sequence:CCGGTAGTGAGGTGGAACCTAAATACTCGAGTATTTAGGTTCCACCTCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-335s21c1
Sequence:CCGGTGATGTCCCGCATGGCCATATCTCGAGATATGGCCATGCGGGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-827s21c1
Sequence:CCGGCTAGAGCATGCTTAAGCATTTCTCGAGAAATGCTTAAGCATGCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032693.2-951s21c1
Sequence:CCGGTCTCACTCTTAACTCTATAAACTCGAGTTTATAGAGTTAAGAGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032693
NAA11 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-605s21c1
Sequence:CCGGAGATGAGCTGAGACGACAAATCTCGAGATTTGTCGTCTCAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-530s21c1
Sequence:CCGGTAGTGAGGTGGAACCTAAATACTCGAGTATTTAGGTTCCACCTCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-335s21c1
Sequence:CCGGTGATGTCCCGCATGGCCATATCTCGAGATATGGCCATGCGGGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-827s21c1
Sequence:CCGGCTAGAGCATGCTTAAGCATTTCTCGAGAAATGCTTAAGCATGCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032693.2-951s21c1
Sequence:CCGGTCTCACTCTTAACTCTATAAACTCGAGTTTATAGAGTTAAGAGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032693
NAA11 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 11, NatA catalytic subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-605s21c1
Sequence:CCGGAGATGAGCTGAGACGACAAATCTCGAGATTTGTCGTCTCAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-530s21c1
Sequence:CCGGTAGTGAGGTGGAACCTAAATACTCGAGTATTTAGGTTCCACCTCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-335s21c1
Sequence:CCGGTGATGTCCCGCATGGCCATATCTCGAGATATGGCCATGCGGGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032693.2-827s21c1
Sequence:CCGGCTAGAGCATGCTTAAGCATTTCTCGAGAAATGCTTAAGCATGCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032693.2-951s21c1
Sequence:CCGGTCTCACTCTTAACTCTATAAACTCGAGTTTATAGAGTTAAGAGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)